BCL2L2 (NM_004050) Human Untagged Clone

CAT#: SC310637

BCL2L2 (untagged)-Human BCL2-like 2 (BCL2L2), transcript variant 1


  "NM_004050" in other vectors (6)

Reconstitution Protocol

SC310637 is the updated version of SC117597.

USD 300.00

5 Days*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Antibody against BCL2L2
    • 400 ul

USD 580.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BCL2L2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL2L2
Synonyms BCL-W; BCL2-L-2; BCLW; PPP1R51
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004050 edited
GGCCCCAGCTGGGGGCTTTCATCCGCCTGACCCGGCTCCACGCTGGCCTTTCATCCTCCT
GGCCAGCGTGGAGCCGGGTCAGGCCGGGAGGATGAAAGGCCCCAGCTGGGGGCTCCTTGC
CACCAGTGCTGTGTCTTAAGAGCTGCCATCCCGGCTGGCCGCCCGGATGGCGACCCCAGC
CTCGGCCCCAGACACACGGGCTCTGGTGGCAGACTTTGTAGGTTATAAGCTGAGGCAGAA
GGGTTATGTCTGTGGAGCTGGCCCCGGGGAGGGCCCAGCAGCTGACCCACTGCACCAAGC
CATGCGGGCAGCTGGAGATGAGTTCGAGACCCGCTTCCGGCGCACCTTCTCTGATCTGGC
GGCTCAGCTGCATGTGACCCCAGGCTCAGCCCAACAACGCTTCACCCAGGTCTCCGATGA
ACTTTTTCAAGGGGGCCCCAACTGGGGCCGCCTTGTAGCCTTCTTTGTCTTTGGGGCTGC
ACTGTGTGCTGAGAGTGTCAACAAGGAGATGGAACCACTGGTGGGACAAGTGCAGGAGTG
GATGGTGGCCTACCTGGAGACGCGGCTGGCTGACTGGATCCACAGCAGTGGGGGCTGGGC
GGAGTTCACAGCTCTATACGGGGACGGGGCCCTGGAGGAGGCGCGGCGTCTGCGGGAGGG
GAACTGGGCATCAGTGAGGACAGTGCTGACGGGGGCCGTGGCACTGGGGGCCCTGGTAAC
TGTAGGGGCCTTTTTTGCTAGCAAGTGAAAGTCCAGGGCCAGGTGGGGCTAGGTGTGGCT
GGGGGCCAGGAGAGCAGGAACAGAACAGAGAAATGCCCTTGGAAGAAGTGGAGTTGGTGG
ATGGGTGGGCATGGAACAGGATGGGCAGAGAAAGGGTAGTGTGTGAGGGAGCTGAGTAGG
CCAGGTAGGCGATTGGAAGAGTGAGCAGGACACAGAGGGGAGGGGAATGTTTTGGCAAGT
TTAGGGGCACAGGAGATGTAGTCGTTCCAGGGCTGGGGGAGGTGGGAGGGATCACGCCTA
TAGGTGTGGGCACATGAAACGACCTGGAACTTGCTTCACAGCCCTGAGGAAGGTGGACTT
ACATAAGCAGCTGTATTCCATTAGATGAGTGGGATTTAGGGAACGCAGAAGGCACATCCC
TTTGGAATGGAAGCTTAGGGGTTCTCAGGTGATAGGGAGAGGTGGCTGTTAACAGTGGGC
TGCTTGGACACGCGTGTGCATGTGCACGCATGCTGGTGTGCATGCTGGGCTGCCTGGCAA
ATCTGGTGGTGGTGGGATTCCTCAAGGAGAAAACATTCCCTCTTGCAATGGCAAGAACTA
GGGGCAGTTCTCTGTCCCTCCTCCCAACCCCTCCTTTCCCCTGCCCTTGTCCTGATGCCT
CAAGGCTTAGAGAGAAACATTGTATCCAGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004050
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004050.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004050.2, NP_004041.1
RefSeq Size 3542 bp
RefSeq ORF 582 bp
Locus ID 599
UniProt ID Q92843
Cytogenetics 14q11.2
Domains Bcl-2, BH4
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.