NRG1 (NM_004495) Human Untagged Clone

CAT#: SC310625

NRG1 (untagged)-Human neuregulin 1 (NRG1), transcript variant HRG-gamma

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NRG1 (NM_004495) Human Untagged Clone
Symbol NRG1
Synonyms ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; MSTP131; NDF; NRG1-IT2; SMDF
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004495 edited
GGGCTCGCGCGGAGGCCAGGAGCTGAGCGGCGGCGGCTGCCGGACGATGGGAGCGTGAGC
AGGACGGTGATAACCTCTCCCCGATCGGGTTGCGAGGGCGCCGGGCAGAGGCCAGGACGC
GAGCCGCCAGCGGCGGGACCCATCGACGACTTCCCGGGGCGACAGGAGCAGCCCCGAGAG
CCAGGGCGAGCGCCCGTTCCAGGTGGCCGGACCGCCCGCCGCGTCCGCGCCGCGCTCCCT
GCAGGCAACGGGAGACGCCCCCGCGCAGCGCGAGCGCCTCAGCGCGGCCGCTCGCTCTCC
CCATCGAGGGACAAACTTTTCCCAAACCCGATCCGAGCCCTTGGACCAAACTCGCCTGCG
CCGAGAGCCGTCCGCGTAGAGCGCTCCGTCTCCGGCGAGATGTCCGAGCGCAAAGAAGGC
AGAGGCAAAGGGAAGGGCAAGAAGAAGGAGCGAGGCTCCGGCAAGAAGCCGGAGTCCGCG
GCGGGCAGCCAGAGCCCAGCCTTGCCTCCCCGATTGAAAGAGATGAAAAGCCAGGAATCG
GCTGCAGGTTCCAAACTAGTCCTTCGGTGTGAAACCAGTTCTGAATACTCCTCTCTCAGA
TTCAAGTGGTTCAAGAATGGGAATGAATTGAATCGAAAAAACAAACCACAAAATATCAAG
ATACAAAAAAAGCCAGGGAAGTCAGAACTTCGCATTAACAAAGCATCACTGGCTGATTCT
GGAGAGTATATGTGCAAAGTGATCAGCAAATTAGGAAATGACAGTGCCTCTGCCAATATC
ACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAGGAGCATAT
GTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACAGAAGGAGCAAATACTTCTTCA
TCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAGAAA
ACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCCTCGAGA
TACTTGTGCAAGTAA
Tag Tag Free
ACCN NM_004495
ORF Size 636 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004495.1, NP_004486
RefSeq Size 1651
RefSeq ORF 636
Locus ID 3084
Cytogenetics 8p12
Domains ig, IGc2, IG
Protein Families Secreted Protein, Transmembrane, Transcription Factors, Druggable Genome
Protein Pathways ErbB signaling pathway
Gene Summary The protein encoded by this gene is a membrane glycoprotein that mediates cell-cell signaling and plays a critical role in the growth and development of multiple organ systems. An extraordinary variety of different isoforms are produced from this gene through alternative promoter usage and splicing. These isoforms are expressed in a tissue-specific manner and differ significantly in their structure, and are classified as types I, II, III, IV, V and VI. Dysregulation of this gene has been linked to diseases such as cancer, schizophrenia, and bipolar disorder (BPD). [provided by RefSeq, Apr 2016].
Transcript Variant: This variant (HRG-gamma), which uses the type I promoter, lacks multiple 3' exons but contains an alternate 3' terminal exon that results in an early stop codon, compared to variant HRG-beta1. The resulting isoform (HRG-gamma) is shorter at the C-terminus, compared to isoform HRG-beta1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.