CCNK (NM_003858) Human Untagged Clone

CAT#: SC310510

TrueClone®, CCNK (untagged)-Human cyclin K (CCNK), transcript variant 2

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CCNK (NM_003858) Human Untagged Clone
Symbol CCNK
Synonyms CPR4; MGC9113; MGC9113; cyclin K
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003858 edited
ATGAAGGAGAATAAAGAAAATTCAAGCCCTTCAGTAACTTCAGCAAACCTGGACCACACA
AAGCCATGTTGGTACTGGGATAAGAAAGACTTGGCTCATACACCCTCACAACTTGAAGGA
CTTGATCCAGCCACCGAGGCCCGGTACCGCCGAGAGGGCGCTCGGTTCATCTTTGATGTG
GGCACACGTTTGGGGCTACACTATGATACCCTGGCAACTGGAATAATTTATTTTCATCGC
TTCTATATGTTTCATTCCTTCAAGCAATTCCCAAGATATGTGACAGGAGCCTGTTGCCTC
TTTCTGGCTGGGAAAGTAGAAGAAACACCAAAAAAATGTAAAGATATCATCAAAACAGCT
CGTAGTTTATTAAATGATGTACAATTTGGCCAGTTTGGAGATGACCCAAAGGAGGAAGTA
ATGGTTCTGGAGAGAATCTTACTGCAGACCATCAAGTTTGATTTACAGGTAGAACATCCA
TACCAGTTCCTACTAAAATATGCAAAGCAACTCAAAGGTGATAAAAACAAAATTCAAAAG
TTGGTTCAAATGGCATGGACATTTGTAAATGACAGTCTCTGCACCACCTTGTCACTGCAG
TGGGAACCAGAGATCATAGCAGTAGCAGTGATGTATCTCGCAGGACGTTTGTGCAAATTT
GAAATACAAGAATGGACCTCCAAACCCATGTATAGGAGATGGTGGGAGCAGTTTGTTCAA
GATGTCCCGGTCGACGTTTTGGAAGACATCTGCCACCAAATCCTGGATCTTTACTCACAA
GGAAAACAACAGATGCCTCATCACACCCCCCATCAGCTGCAACAGCCCCCATCTCTTCAG
CCTACACCACAAGTGCCGCAAGTACAGCAGTCACAGCCGTCTCAAAGCTCCGAACCATCC
CAGCCCCAGCAGAAGGACCCCCTCATCCTCCTCCAGGGTTGGGCCTGCCGCCAGCCAGCT
ACCCACCTCCTGCCGTCCCCCCTGGAGGACAGCCTCCTGTGCCCCCGCCCATTCCCCCAC
CCGGCATGCCTCCAGTTGGGGGGCTGGGGCGGGCAGCCTGGATGA
5' Read Nucleotide Sequence
>Reverse primer walk for NM_003858 unedited
CTCATGGTTTGAAGTCCCTCTTGTTTCAAATTGAACACACTCCTGNCGNAGNATACATCA
NNCTGCTACTGCTATGATCTCTGGTTCCCACTGCAGTGACAAGGTGGTGCAGAGACTGTC
ATTTACAAATGTCCATGCCATTTGAACCAACTTTTGAATTTTGTTTTTATCACCTTTGAG
TTGCTTTGCATATTTTAGTAGGAACTGGTATGGATGTTCTACCTGTAAATCAAACTTGAT
GGTCTGCAGTAAGATTCTCTCCAGAACCATTACTTCCTCCTTTGGGTCATCTCCAAACTG
GCCAAATTGTACATCATTTAATAAACTACGAGCTGTTTTGATGATATCTTTACATTTTTT
TGGTGTTTCTTCTACTTTCCCAGCCAGAAAGAGGCAACAGGCTCCTGTCACATATCTTGG
GAATTGCTTGAAGGAATGAAACATATAGAAGCGATGAAAATAAATTATTCCAGTTGCCAG
GGTATCATAGTGTAGCCCCAAACGTGTGCCCACATCAAAGATGAACCGAGCGCCCTCTCG
GCGGTACCGGGCCTCGGTGGCTGGATCAAGTCCTTCAAGTTGTGAGGGTGTATGAGCCAA
GTCTTTCTTATCCCAGTACCAACATGGCTTTGTGTGGTCCAAGTTTGCTGAAATTACTGA
AGGGCTTGAATTTTCTTTATTCTCCTTCATTTATTGAAGTAAGCTTGTTCTTTCCAAAAG
GTTCTCTGAAAAAGTTAAAATCCCCTCGCTTCAAGCAAGCCCCCTCAGCGACGTCTTCTC
TTGACCACTGCGGCCTCGTGCCCGAATTCCCGGACCCCCTTTAATGAGTCTATTTACAAA
AATTCTTAACGGTCCCTAAAACAAGCTTTCCTTATTAAAACT
Tag Tag Free
ACCN NM_003858
ORF Size 1065 bp
Insert Size 1700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003858.2, NP_003849
RefSeq Size 1946
RefSeq ORF 1065
Locus ID 8812
Cytogenetics 14q32.2
Protein Families Transcription Factors, Druggable Genome
Gene Summary The protein encoded by this gene is a member of the transcription cyclin family. These cyclins may regulate transcription through their association with and activation of cyclin-dependent kinases (CDK) that phosphorylate the C-terminal domain (CTD) of the large subunit of RNA polymerase II. This gene product may play a dual role in regulating CDK and RNA polymerase II activities. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses alternate splice sites in the 3' coding region and lacks two coding exons, compared to variant 1, resulting in a shorter protein (isoform 2) with a unique C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.