Kv4.3 (KCND3) (NM_004980) Human Untagged Clone

CAT#: SC310189

KCND3 (untagged)-Human potassium voltage-gated channel, Shal-related subfamily, member 3 (KCND3), transcript variant 1


  "NM_004980" in other vectors (6)

Reconstitution Protocol

USD 611.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
KCND3 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Kv4.3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Kv4.3
Synonyms BRGDA9; KCND3L; KCND3S; KSHIVB; KV4.3; SCA19; SCA22
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_004980 edited
GCGGGGCCCGGGCTGGCTTCGCGGAAGGGTTTGCTGAACTAACTCCAAGCTGGTGTGCCT
AGCGTCCGCGCGGCTGCCGGCCCAAGAGCTGGAGTCACCATGGCGGCCGGAGTTGCGGCC
TGGCTGCCTTTTGCCCGGGCTGCGGCCATCGGGTGGATGCCGGTGGCCAACTGCCCCATG
CCCCTGGCCCCGGCCGACAAGAACAAGCGGCAGGATGAGCTGATTGTCCTCAACGTGAGT
GGGCGGAGGTTCCAGACCTGGAGGACCACGCTGGAGCGCTACCCGGACACCCTGCTGGGC
AGCACGGAGAAGGAGTTCTTCTTCAACGAGGACACCAAGGAGTACTTCTTCGACCGGGAC
CCCGAGGTGTTCCGCTGCGTGCTCAACTTCTACCGCACGGGGAAGCTGCACTACCCGCGC
TACGAGTGCATCTCTGCCTACGACGACGAGCTGGCCTTCTACGGCATCCTCCCGGAGATC
ATCGGGGACTGCTGCTACGAGGAGTACAAGGACCGCAAGAGGGAGAACGCCGAGCGGCTC
ATGGACGACAACGACTCGGAGAACAACCAGGAGTCCATGCCCTCGCTCAGCTTCCGCCAG
ACCATGTGGCGGGCCTTCGAGAACCCCCACACCAGCACGCTGGCCCTGGTCTTCTACTAC
GTGACTGGCTTCTTCATCGCTGTCTCGGTCATCACCAACGTGGTGGAGACGGTGCCGTGC
GGCACGGTCCCGGGCAGCAAGGAGCTGCCGTGCGGGGAGCGCTACTCGGTGGCCTTCTTC
TGCCTGGACACGGCGTGCGTCATGATCTTCACCGTGGAGTACCTCCTGCGGCTCTTCGCG
GCTCCCAGCCGCTACCGCTTCATCCGCAGCGTCATGAGCATCATCGACGTGGTGGCCATC
ATGCCCTACTACATCGGTCTGGTCATGACCAACAACGAGGACGTGTCCGGCGCCTTCGTC
ACGCTCCGGGTCTTCCGCGTCTTCAGGATCTTCAAGTTTTCCCGCCACTCCCAGGGCCTG
CGGATCCTGGGCTACACACTGAAGAGCTGTGCCTCCGAACTGGGCTTTCTTCTCTTCTCC
CTCACCATGGCCATCATCATCTTTGCCACTGTGATGTTTTATGCCGAGAAGGGCTCCTCG
GCCAGCAAGTTCACAAGCATCCCTGCCTCGTTTTGGTACACCATTGTCACCATGACCACA
CTGGGATACGGAGACATGGTGCCTAAGACGATTGCAGGGAAGATCTTCGGCTCCATCTGC
TCCTTGAGTGGCGTCCTGGTCATTGCCCTGCCAGTCCCTGTGATTGTTTCCAACTTTAGC
CGGATTTACCACCAGAATCAGAGAGCTGATAAACGCAGGGCACAAAAGAAGGCCCGCCTT
GCCAGGATCCGTGTGGCCAAAACAGGCAGTTCGAATGCATACCTGCACAGCAAGCGCAAC
GGGCTCCTCAACGAGGCGCTGGAGCTGACGGGCACCCCAGAAGAGGAGCACATGGGCAAG
ACCACCTCACTCATCGAGAGCCAGCATCATCACCTGCTGCACTGCCTGGAAAAAACCACT
GGGTTGTCCTATCTTGTGGATGATCCCCTGTTATCTGTACGAACCTCCACCATCAAGAAC
CACGAGTTTATTGATGAGCAGATGTTTGAGCAGAACTGCATGGAGAGTTCAATGCAGAAC
TACCCATCCACAAGAAGTCCCTCACTGTCCAGCCACCCAGGCCTCACTACCACCTGCTGC
TCCCGTCGTAGTAAGAAGACCACACACCTGCCCAATTCTAACCTGCCAGCTACTCGCCTG
CGCAGCATGCAAGAGCTCAGCACGATCCACATCCAGGGCAGTGAGCAGCCCTCCCTCACA
ACCAGTCGCTCCAGCCTTAATTTGAAAGCAGACGACGGACTGAGACCAAACTGCAAAACA
TCCCAGATCACCACAGCCATCATCAGCATCCCCACTCCCCCAGCGCTAACCCCAGAGGGG
GAAAGTCGGCCACCCCCTGCCAGCCCAGGCCCCAACACGAACATTCCTTCCATAGCCAGC
AATGTTGTCAAGGTCTCCGCCTTGTAAAACCACTGGACAGAGGGCCAGAGTGGGTAGTGG
GGAATGAAGGGGACTGGCATGTTGGTGGGTGGTCACTGAGACCACTCCCTCCCCCCTTTC
CCCACTA
>OriGene 5' read for NM_004980 unedited
NGACGTCAAATTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGCGGCGGC
TGCTGGGCGCTTCCCCGCGCTGCTGGGCGCTCGGCGCCTCCGCGGCCCCGGCTCCCGGCC
GCAGCTTCCTCGCGCGCGCGGGGCGCCGGGCGCGGGGCCCGGGCTGGCTTCGCGGAAGGG
TTTGCTGAACTAACTCCAAGCTGGTGTGCCTAGCGTCCGCGCGGCTGCCGGCCCAAGAGC
TGGAGTCACCATGGCGGCCGGAGTTGCGGCCTGGCTGCCTTTTGCCCGGGCTGCGGCCAT
CGGGTGGATGCCGGTGGCCAACTGCCCCATGCCCCTGGCCCCGGCCGACAAGAACAAGCG
GCAGGATGAGCTGATTGTCCTCAACGTGAGTGGGCGGAGGTTCCAGACCTGGAGGACCAC
GCTGGAGCGCTACCCGGACACCCTGCTGGGCAGCACGGAGAAGGAGTTCTTCTTCAACGA
GGACACCAAGGAGTACTTCTTCGACCGGGACCCCGAGGTGTTCCGCTGCGTGCTCAACTT
CTACCGCACGGGGAAGCTGCACTACCCGCGCTACGAGTGCATCTCTGCCTACGACGACGA
GCTGGCCTTCTACGGCATCCTCCCGGAGATCATCGGGGACTGCTGCTACGAGGAGTACAA
GGACCGCAAGAGGGAGAACGCCGAGCGGCTCATGGACGACAACGACTCGGAGAACAACCA
GGAGTCCATGCCCTCGCTCAGCTTCCGCCAGACCATGTTGGCGGGCCTTCGAGAACCCCC
ACACCAGCACGCTGGCCCTGGTCTTCTACTACGTGACTGGCTTCTTCATCGCTGTCTCGG
TCATCACCAACGTGGTGGGAGACGGTGCCGTGCGGCACGGTCC
Restriction Sites Please inquire     
ACCN NM_004980
Insert Size 2200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004980.3, NP_004971.2
RefSeq Size 2693 bp
RefSeq ORF 1968 bp
Locus ID 3752
UniProt ID Q9UK17
Cytogenetics 1p13.2
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as the long splice variant, encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.