PDE4D (NM_006203) Human Untagged Clone

CAT#: SC310179

PDE4D (untagged)-Human phosphodiesterase 4D, cAMP-specific (PDE4D), transcript variant 2

USD 1,288


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PDE4D (NM_006203) Human Untagged Clone
Symbol PDE4D
Synonyms ACRDYS2; DPDE3; HSPDE4D; PDE43; PDE4DN2; STRK1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_006203 edited
ATGCACGTGAATAATTTTCCCTTTAGAAGGCATTCCTGGATATGTTTTGATGTGGACAAT
GGCACATCTGCGGGACGGAGTCCCTTGGATCCCATGACCAGCCCAGGATCCGGGCTAATT
CTCCAAGCAAATTTTGTCCACAGTCAACGACGGGAGTCCTTCCTGTATCGATCCGACAGC
GATTATGACCTCTCTCCAAAGTCTATGTCCCGGAACTCCTCCATTGCCAGTGATATACAC
GGAGATGACTTGATTGTGACTCCATTTGCTCAGGTCTTGGCCAGTCTGCGAACTGTACGA
AACAACTTTGCTGCATTAACTAATTTGCAAGATCGAGCACCTAGCAAAAGATCACCCATG
TGCAACCAACCATCCATCAACAAAGCCACCATAACAGAGGAGGCCTACCAGAAACTGGCC
AGCGAGACCCTGGAGGAGCTGGACTGGTGTCTGGACCAGCTAGAGACCCTACAGACCAGG
CACTCCGTCAGTGAGATGGCCTCCAACAAGTTTAAAAGGATGCTTAATCGGGAGCTCACC
CATCTCTCTGAAATGAGTCGGTCTGGAAATCAAGTGTCAGAGTTTATATCAAACACATTC
TTAGATAAGCAACATGAAGTGGAAATTCCTTCTCCAACTCAGAAGGAAAAGGAGAAAAAG
AAAAGACCAATGTCTCAGATCAGTGGAGTCAAGAAATTGATGCACAGCTCTAGTCTGACT
AATTCAAGTATCCCAAGGTTTGGAGTTAAAACTGAACAAGAAGATGTCCTTGCCAAGGAA
CTAGAAGATGTGAACAAATGGGGTCTTCATGTTTTCAGAATAGCAGAGTTGTCTGGTAAC
CGGCCCTTGACTGTTATCATGCACACCATTTTTCAGGAACGGGATTTATTAAAAACATTT
AAAATTCCAGTAGATACTTTAATTACATATCTTATGACTCTCGAAGACCATTACCATGCT
GATGTGGCCTATCACAACAATATCCATGCTGCAGATGTTGTCCAGTCTACTCATGTGCTA
TTATCTACACCTGCTTTGGAGGCTGTGTTTACAGATTTGGAGATTCTTGCAGCAATTTTT
GCCAGTGCAATACATGATGTAGATCATCCTGGTGTGTCCAATCAATTTCTGATCAATACA
AACTCTGAACTTGCCTTGATGTACAATGATTCCTCAGTCTTAGAGAACCATCATTTGGCT
GTGGGCTTTAAATTGCTTCAGGAAGAAAACTGTGACATTTTCCAGAATTTGACCAAAAAA
CAAAGACAATCTTTAAGGAAAATGGTCATTGACATCGTACTTGCAACAGATATGTCAAAA
CACATGAATCTACTGGCTGATTTGAAGACTATGGTTGAAACTAAGAAAGTGACAAGCTCT
GGAGTTCTTCTTCTTGATAATTATTCCGATAGGATTCAGGTTCTTCAGAATATGGTGCAC
TGTGCAGATCTGAGCAACCCAACAAAGCCTCTCCAGCTGTACCGCCAGTGGACGGACCGG
ATAATGGAGGAGTTCTTCCGCCAAGGAGACCGAGAGAGGGAACGTGGCATGGAGATAAGC
CCCATGTGTGACAAGCACAATGCTTCCGTGGAAAAATCACAGGTGGGCTTCATAGACTAT
ATTGTTCATCCCCTCTGGGAGACATGGGCAGACCTCGTCCACCCTGACGCCCAGGATATT
TTGGACACTTTGGAGGACAATCGTGAATGGTACCAGAGCACAATCCCTCAGAGCCCCTCT
CCTGCACCTGATGACCCAGAGGAGGGCCGGCAGGGTCAAACTGAGAAATTCCAGTTTGAA
CTAACTTTAGAGGAAGATGGTGAGTCAGACACGGAAAAGGACAGTGGCAGTCAAGTGGAA
GAAGACACTAGCTGCAGTGACTCCAAGACTCTTTGTACTCAAGACTCAGAGTCTACTGAA
ATTCCCCTTGATGAACAGGTTGAAGAGGAGGCAGTAGGGGAAGAAGAGGAAAGCCAGCCT
GAAGCCTGTGTCATAGATGATCGTTCTCCTGACACGTAA
5' Read Nucleotide Sequence
>Reverse primer walk for NM_006203 unedited
CTACATGTAAGGACTCCCGTCTGTGACTGTGGACAAAATTTGCTTGGACAATTAACCCGG
ATCCTGGGCTGCTCATGGGATCCAAGGGACTCCGTCCCGCAAATGTGCCATTGTCCACAT
CAAAACATATCCAGGAATGCCTTCTAGAGGGAAAATTATTCACGTGCATCATGTTCCCAT
ATCTTCTGTCATTAATATTTTTCTTGTCTCCTACGTTACATGTAGTGATTTTTACAGATG
AATTCCAACTCTCTTGTTTGAGCAACTATCGTGCGCAATTATTGCAACACGTATTGAATC
CCAAAAAAAAAAAAAAAATCTCCCCCCACCAATAAAAACAAATAGCACTTACAAAAGGCC
TTCCATGATTTGAAAAAACAAACATCACAGAACACTGCAGGTATGGATCCATCCATTTAG
GTTCCACTATTTAGTCTACATACTCAAATAACCAGTTCAACTAATAATCCTAACTGGCGG
CCAATATTGTCCTGGAAAAATCTAACCGCCTTGAGTGTGAATTAATGCATCCTTAACGAA
GGACTCTGGAATGTGGGAAGAGAGGAGTCAAAAGACAGTTTCTTGATATCCTTGCTAAAC
AAGTGTTCGCATGGAAATGGAAAACTTCAGGTTGCTTTGCCATGCTCGTCTTTAGCAATG
AATATTGCTTTCTTCTCTTTCTTAGCACATATTCATGTCTGGTCACTTTAACGCAGTGCT
ACCGTCTGAGACGTGTCGTACTAAGCCTGTGCTGACGGGCTAGCAACCTGTATCACCAAA
GCCCACTTCTTTCCCAGATTCAGAATTGCTGGTTCAACTGCTAAGTANG
3' Read Nucleotide Sequence
>OriGene 3' genomic read for NM_006203 unedited
GTTCATACTGTTGCATATTGCCCACNAAGCTGCTCAAACAAAGATTGGAATTCATCTGTA
AAAATCACTACATGTAACGTAGGAGACAAGAAAAATATTAATGACAGAAGATCTGCGAAC
ATGATGCACGTGAATAATTTTCCCTTTAGAAGGCATTCCTGGATATGTTTTGATGTGGAC
AATGGCACATCTGCGGGACGGAGTCCCTTGGATCCCATGACCAGCCCCAGATCCGGNNCT
ATTCTNCNAGCANATTTTGTCCACAGTCAACGACGGNAGTCCCTTCTGTATCGATCCGAC
AGCGATTATGACCTCTCTCCAAAGTCTATGTCCCNGGACTCCTNCATTTGCAGTGATATA
CCCGAGAATGACTTGAGTGGGACTCCATTTGCCTCAGGTCTGGGCCATCTTGCAAACTGT
ACAAAACAACTTTTGCTGCTTAACCTAATTTGCAGATCGGCCCCCTGGCCAAGATCACCC
TTGTGCCAACCACCCTCCTTTAAACAAAGCCCCCTTAACAAAGAGGCCCTCCCCAAAACG
GGCCCCCCGAACCCCTGAAAAACCTGACTTGGGTTTTGGCCCCCTTTTGAAACCCTTAAA
ACAGACCCCTCCTCCGTGGAAAAGGGCCCCCCCCAATTTTTTAAAAGAGGGGTTTTATTG
GGGGGCCCCCCCCCCCCCTTCTTTAAAAAAAAGGGGGGCCCGGGGGAAAAAAAAGGGGGC
GGAGATTTTTATTATTACAACCACTTTTTTTTAATAATAACACCCCGAGAGGGGGGGAGA
AACTCTTTTCTCTCCCCCCCCCCCGGGGGGGGGGGGGGAGAAAAAAAAAAACACCCCTCT
TTCTCTCTTCTAATTGGGGGTTGGACAAAAAAATTTTTTCGCCCCCCCCTCTTTTTTTT
Tag Tag Free
ACCN NM_006203
ORF Size 2022 bp
Insert Size 7000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006203.3, NP_006194
RefSeq Size 5876
RefSeq ORF 2022
Locus ID 5144
Cytogenetics 5q11.2-q12.1
Domains PDEase
Protein Families Druggable Genome
Protein Pathways Purine metabolism, Progesterone-mediated oocyte maturation
Gene Summary This gene encodes one of four mammalian counterparts to the fruit fly 'dunce' gene. The encoded protein has 3',5'-cyclic-AMP phosphodiesterase activity and degrades cAMP, which acts as a signal transduction molecule in multiple cell types. This gene uses different promoters to generate multiple alternatively spliced transcript variants that encode functional proteins.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region, compared to variant 1. Isoform PDE4D3 (also known as isoform 2) is shorter and has a distinct N-terminus, compared to isoform PDE4D4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.