TRPC6 (NM_004621) Human Untagged Clone

CAT#: SC310040

TRPC6 (untagged)-Human transient receptor potential cation channel, subfamily C, member 6 (TRPC6)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TRPC6 (NM_004621) Human Untagged Clone
Symbol TRPC6
Synonyms FSGS2; TRP6
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004621 edited
CCCGCTGGAACTGCCCACTCGGCTCCCCCGGGAGCGGGGCCCAGGCCAGTCGGGCGTTCC
CGCCATGAGCCAGAGCCCGGCGTTCGGGCCCCGGAGGGGCAGTTCTCCCCGGGGCGCTGC
CGGAGCCGCTGCGCGGCGCAACGAGAGCCAGGACTATCTGCTCATGGACTCGGAGCTGGG
AGAAGACGGCTGCCCGCAAGCCCCGCTGCCTTGCTACGGCTACTACCCCTGCTTCCGGGG
ATCTGACAACAGACTGGCTCACCGGCGGCAGACAGTTCTCCGTGAGAAGGGGAGAAGGTT
AGCTAATCGAGGACCAGCATACATGTTTAGTGATCGCTCCACAAGCCTATCTATAGAGGA
GGAACGCTTTTTGGATGCAGCTGAATATGGTAACATCCCAGTGGTGCGGAAGATGTTAGA
AGAATGCCACTCACTCAACGTTAACTGTGTGGATTACATGGGCCAGAATGCCCTACAGTT
GGCAGTGGCCAATGAGCATCTGGAAATTACAGAACTTCTTCTCAAGAAAGAAAACCTCTC
TCGAGTTGGGGATGCTTTGCTTCTAGCTATTAGTAAAGGTTATGTTCGGATTGTGGAAGC
AATTCTCAGTCATCCGGCTTTTGCTGAAGGCAAGAGGTTAGCAACCAGCCCTAGCCAGTC
TGAACTCCAGCAAGATGATTTTTATGCCTATGATGAAGATGGGACACGGTTCTCCCATGA
TGTGACTCCAATCATTCTGGCTGCCCACTGCCAGGAATATGAAATTGTGCATACCCTCCT
GCGGAAGGGTGCTAGGATTGAACGGCCTCATGATTATTTCTGCAAGTGCAATGACTGCAA
CCAGAAACAGAAGCATGACTCGTTTAGCCACTCCAGATCTAGGATTAATGCCTATAAAGG
CCTGGCAAGTCCGGCTTACCTGTCATTGTCTAGTGAAGATCCAGTCATGACGGCTTTAGA
ACTTAGCAATGAACTGGCAGTTCTGGCCAATATTGAGAAAGAGTTCAAGAATGACTACAA
AAAACTGTCAATGCAGTGCAAAGACTTTGTTGTTGGACTCCTTGATCTGTGCAGAAACAC
TGAAGAAGTCGAGGCCATTCTGAATGGGGATGTTGAAACGCTCCAGAGTGGTGATCACGG
TCGCCCAAATCTCAGCCGTTTAAAACTTGCCATTAAATATGAAGTAAAAAAATTTGTAGC
TCATCCAAACTGCCAACAGCAACTTCTCTCCATTTGGTATGAGAATCTTTCTGGTTTACG
ACAGCAGACAATGGCGGTCAAGTTCCTTGTGGTCCTTGCTGTTGCCATTGGACTGCCCTT
CCTGGCTCTCATTTACTGGTTTGCTCCATGCAGCAAGATGGGGAAGATAATGCGTGGACC
ATTCATGAAGTTTGTAGCACACGCAGCCTCCTTCACCATTTTTCTGGGACTGCTAGTCAT
GAATGCAGCTGACAGATTTGAAGGCACAAAACTCCTTCCTAATGAAACCAGCACAGATAA
TGCAAAACAGCTGTTCAGGATGAAAACATCCTGCTTCTCATGGATGGAGATGCTCATTAT
ATCCTGGGTAATAGGCATGATATGGGCTGAATGTAAAGAAATCTGGACTCAGGGCCCCAA
GGAATATTTGTTTGAGTTGTGGAACATGCTTGATTTTGGTATGTTAGCAATTTTCGCAGC
ATCATTCATTGCGAGATTCATGGCATTTTGGCATGCTTCCAAAGCCCAGAGCATCATTGA
CGCAAACGATACTTTGAAGGACTTGACGAAAGTAACATTGGGAGACAATGTGAAATACTA
CAATTTGGCCAGGATAAAGTGGGACCCCTCTGATCCTCAAATAATATCTGAAGGTCTTTA
TGCAATTGCTGTAGTTTTAAGTTTCTCTAGGATAGCTTATATTTTACCAGCAAATGAAAG
CTTTGGACCTCTGCAGATATCACTTGGAAGAACAGTCAAAGACATCTTCAAGTTCATGGT
CATATTCATTATGGTGTTTGTGGCCTTTATGATTGGAATGTTCAATCTCTACTCCTACTA
CATTGGTGCAAAACAAAATGAAGCCTTCACAACAGTTGAAGAGAGTTTTAAGACACTGTT
CTGGGCTATATTTGGACTTTCTGAAGTGAAATCAGTGGTCATCAACTATAACCACAAATT
CATTGAAAACATTGGTTACGTTCTTTATGGAGTCTATAATGTTACGATGGTCATTGTTTT
GCTAAATATGTTAATTGCCATGATCAACAGTTCATTCCAGGAAATTGAGGATGACGCTGA
TGTGGAGTGGAAATTTGCAAGGGCCAAACTCTGGTTTTCCTACTTTGAGGAGGGCAGAAC
ACTTCCTGTACCCTTCAATCTGGTGCCGAGTCCAAAGTCCCTGTTTTATCTCTTACTGAA
GCTTAAAAAATGGATTTCTGAGCTGTTCCAGGGCCATAAAAAAGGTTTCCAGGAAGATGC
AGAGATGAACAAGATAAATGAAGAAAAGAAACTTGGAATTTTAGGAAGTCATGAAGACCT
TTCAAAATTATCACTTGACAAAAAACAGGTTGGGCACAATAAACAACCAAGTATAAGGAG
CTCAGAAGATTTCCATCTAAATAGTTTCAATAATCCTCCAAGACAATATCAGAAAATAAT
GAAAAGGCTCATTAAAAGATATGTACTGCAGGCCCAGATAGATAAGGAGAGTGATGAAGT
GAACGAAGGGGAACTGAAGGAAATTAAGCAGGACATCTCAAGTCTCCGCTATGAACTCCT
TGAAGAAAAATCTCAGAATACAGAAGACCTAGCAGAACTTATTAGAGAACTTGGAGAGAA
ATTATCCATGGAACCAAATCAAGAGGAAACCAATAGATAATGCGAAGACTTCCTTAGAAA
TTCATATTTATTTGTCCACTTGAAGCCATATTATTTTCTGATTTATTTTCTTAAGTGCCA
ATGGGCCCACCTTTTAAACAAGAAAACGTTAAATAACTTGGGCCATCCTATCATCTGGAG
CCCTAGTATCTAATTTTTTTGGTGATTAAACTCCATTGTTCAGGGTAAAGGCTGTAGATA
ATGAGGAAAATTATGCCCAGTTGTTTGGTGCTTGTTTTATAAACTGCTTTCTTGGATATA
ACTAACTCTTGTGATGATGTCATTGCCATGTAGTGTCTGCCTGAAAATGGGTCCCAGCGG
ACAGGGGCTGACCCACGTTACTCCCCATGCGGTTTTTCCTCTGAAGTTTATTTCAGGTTC
CTTCTTGCCTGCTCTGTGGATCCCCTGCTGGGGACTCCCAGCTCTGAAATTTGGGAAAAA
GTAGCCCATGGGCCTTTAGAATGCTTTAATCCTTTCTTTAGAATGCTGTTTAAACACCAT
TTACCCTACTTATCCCTCAATGCACATGATTGATACCGTTCATACAAAATGGTCTTACAT
CTATGTAAAATTTTCTGATTCATCTATTTGAAAACATTACACTTAACAATGAAAAAAGTT
TTTCCTCCACTGAACCCTGGAAACATGGTCCAGTTTTGTGTGTGTGCGTGTGTGTAAATG
TGTACACACAGACATAAAGTACTTGCCCTATTTAGTTTGTGGCTAATGTGGACACACAAA
AGCTCTTTATGTTATAAATTTTTATTGTCACTAAAAAATTTTACTGTCTAAATAAGTACC
TTTTATTGGAGAAAAATCAAAACCCCAAACAAACACTGTGGTTGTTTGGTTCCATTATAG
CACAATTTTGTGCCATTTCTGGGAGCATTTACAGATGAATCCCCACACTTAGCCATTGAA
TGTAAAGGGGAAAAATAAGGTGAGAATTTGTAAATACTTATCTGTTATTTTCAATATGTT
CTATCCTTCTACCCAAATATATAAAACAGGAATTTGCATTCATGTGCATTTACCAAGAGG
TTGTTGTTGTTACTTACTGATCATGTGAAGTGGTGTCTTAAACAACTAAAAGCGATGAAG
GTTCATATGTTTACTCAAAGACCATTGGCATTCAGAGGATGCTGGACATTAACTGGAACT
GCTACTTCCAATTCAATAATGGGAGATTTCAAATGCAAATCTTTAACTTCATCTTAAAGA
TGAAATGGTTGCAGAAAATCTGTTTAGCTCCAACTTTGGCTTAATTTAAATCAAAGAACA
TTTATGTAACCAGATCAGAAAATACAGCTGAAAATT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004621 unedited
TCGACAGCTGTATACGACTTACTATAGGGCGGCCGCGAATTCGCCCTTCCCGCCGGAACC
GCCCACTCGGCTCCCCCGGGAGCGGGGCCCAGGCCAGTCGGGCGTTCCCGCCATGAGCCA
GAGCCCGGCGTTCGGGCCCCGGAGGGGCAGTTCTCCCCGGGGCGCTGCCGGAGCCGCTGC
GCGGCGCAACGAGAGCCAGGACTATCTGCTCATGGACTCGGAGCTGGGAGAAGACGGCTG
CCCGCAAGCCCCGCTGCCTTGCTACGGCTACTACCCCTGCTTCCGGGGACCTGACAACAG
ACTGGCTCACCGGCGGCAGACAGTTCTCCGTGAGAAGGGGAGAAGGTTAGCTAATCGAGG
ACCAGCATACATGTTTAGTGATCGCTCCACAAGCCTATCTATAGAGGAGGAACGCTTTTT
GGATGCAGCTGAATATGGTAACATCCCAGTGGTGCGGAAGATGTTAGAAGAATGCCACTC
ACTCAACGTTAACTGTGTGGATTACATGGGCCAGAATGCCCTACAGTTGGCAGTGGCCAA
TGAGCATCTGGAAATTACAGAACTTCTTCTCAAGAAAGAAAACCTCTCTCGAGTTGGGGA
TGCTTTGCTTCTAGCTATTAGTAAAGGTTATGTTCGGATTGTGGAAGCAATTCTCAGTCA
TCCGGCTTTTGCTGAAGGCAAGAGGTTAGCAACCAGCCCTAGCCAGTCTGAACTCCAGCA
AGATGATTTTTATGCCTATGATGAAGATGGGACACGGTTCTCCCATGATGTGACTCCAAT
CATTCTGGCTGCCCACTGCCAGGAATATGAAATTGTGCATACCCTCCTGCGGAAGGTGCT
AGGATTGAACGGCCTCATGATTATTTCTGCAGTGCAATGACTGCACCAGAACAGAGCATG
ACTCGTTTAGCCCCTCCAGATCTAGGATAATGCCTATAAGGCCTGGCAAGTCCGCTTACC
TGTCATGT
Tag Tag Free
ACCN NM_004621
ORF Size 2796 bp
Insert Size 4200
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004621.3, NP_004612
RefSeq Size 4564
RefSeq ORF 2796
Locus ID 7225
Cytogenetics 11q22.1
Domains ANK, ion_trans
Protein Families Ion Channels: Transient receptor potential, Transmembrane, Druggable Genome
Gene Summary The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations