HFE (NM_139009) Human Untagged Clone

CAT#: SC309414

HFE (untagged)-Human hemochromatosis (HFE), transcript variant 9

USD 618


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HFE (NM_139009) Human Untagged Clone
Symbol HFE
Synonyms HFE1; HH; HLA-H; MVCD7; TFQTL2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_139009, the custom clone sequence may differ by one or more nucleotides
ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTG
CAGGGGCGCTTGCTGCCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCAT
GAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATG
TGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGG
ACTATTATGGAAAATCACAACCACAGCAAGGAGTCCCACACCCTGCAGGTCATCCTGGGC
TGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAG
GACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGG
CCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTG
GAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGAC
CAACAAGTGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTA
CGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAG
CAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACC
TACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAG
GTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCACCGTCTGGC
ACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTGTTCATTGGA
ATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGGCACTACGTC
TTAGCTGAACGTGAGTGA
Tag Tag Free
ACCN NM_139009
ORF Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_139009.1, NP_620578
RefSeq Size 1280
RefSeq ORF 978
Locus ID 3077
Cytogenetics 6p22.2
Protein Families Transmembrane, Druggable Genome
Gene Summary The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (9) lacks an internal in-frame segment of the coding region through the use of an alternate splice acceptor site, as compared to variant 1, resulting in a shorter protein (isoform 9).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.