Nicotinic Acetylcholine Receptor beta 2 (CHRNB2) (NM_000748) Human Untagged Clone

CAT#: SC309051

Reviews ()
Write a review

CHRNB2 (untagged)-Human cholinergic receptor, nicotinic, beta 2 (neuronal) (CHRNB2)



Reconstitution Protocol

USD 836.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHRNB2
Synonyms EFNL3; nAChRB2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000748 edited
CCCAGGAACCACCGCGGCGGCCGGCACCACCTGGACCCAGCTCCAGGCGGGCGCGGCTTC
AGCACCACGGACAGCGCCCCACCCGCGGCCCTCCCCCCGGCGGCGCGCTCCAGCCGGTGT
AGGCGAGGCAGCGAGCTATGCCCGCGGCATGGCCCGGCGCTGCGGCCCCGTGGCGCTGCT
CCTTGGCTTCGGCCTCCTCCGGCTGTGCTCAGGGGTGTGGGGTACGGATACAGAGGAGCG
GCTGGTGGAGCATCTCCTGGATCCTTCCCGCTACAACAAGCTTATCCGCCCAGCCACCAA
TGGCTCTGAGCTGGTGACAGTACAGCTTATGGTGTCACTGGCCCAGCTCATCAGTGTGCA
TGAGCGGGAGCAGATCATGACCACCAATGTCTGGCTGACCCAGGAGTGGGAAGATTATCG
CCTCACCTGGAAGCCTGAAGAGTTTGACAACATGAAGAAAGTTCGGCTCCCTTCCAAACA
CATCTGGCTCCCAGATGTGGTCCTGTACAACAATGCTGACGGCATGTACGAGGTGTCCTT
CTATTCCAATGCCGTGGTCTCCTATGATGGCAGCATCTTCTGGCTGCCGCCTGCCATCTA
CAAGAGCGCATGCAAGATTGAAGTAAAGCACTTCCCATTTGACCAGCAGAACTGCACCAT
GAAGTTCCGTTCGTGGACCTACGACCGCACAGAGATCGACTTGGTGCTGAAGAGTGAGGT
GGCCAGCCTGGACGACTTCACACCTAGTGGTGAGTGGGACATCGTGGCGCTGCCGGGCCG
GCGCAACGAGAACCCCGACGACTCTACGTACGTGGACATCACGTATGACTTCATCATTCG
CCGCAAGCCGCTCTTCTACACCATCAACCTCATCATCCCCTGTGTGCTCATCACCTCGCT
AGCCATCCTTGTCTTCTACCTGCCATCCGACTGTGGCGAGAAGATGACGTTGTGCATCTC
AGTGCTGCTGGCGCTCACGGTCTTCCTGCTGCTCATCTCCAAGATCGTGCCTCCCACCTC
CCTCGACGTGCCGCTCGTCGGCAAGTACCTCATGTTCACCATGGTGCTTGTCACCTTCTC
CATCGTCACCAGCGTGTGCGTGCTCAACGTGCACCACCGCTCGCCCACCACGCACACCAT
GGCGCCCTGGGTGAAGGTCGTCTTCCTGGAGAAGCTGCCCGCGCTGCTCTTCATGCAGCA
GCCACGCCATCATTGCGCCCGTCAGCGCCTGCGCCTGCGGCGACGCCAGCGTGAGCGCGA
GGGCGCTGGAGCCCTCTTCTTCCGCGAAGCCCCAGGGGCCGACTCCTGCACGTGCTTCGT
CAACCGCGCGTCGGTGCAGGGGTTGGCCGGGGCCTTCGGGGCTGAGCCTGCACCAGTGGC
GGGCCCCGGGCGCTCAGGGGAGCCGTGTGGCTGTGGCCTCCGGGAGGCGGTGGACGGCGT
GCGCTTCATCGCAGACCACATGCGGAGCGAGGACGATGACCAGAGCGTGAGTGAGGACTG
GAAGTACGTCGCCATGGTGATCGACCGCCTCTTCCTCTGGATCTTTGTCTTTGTCTGTGT
CTTTGGCACCATCGGCATGTTCCTGCAGCCTCTCTTCCAGAACTACACCACCACCACCTT
CCTCCACTCAGACCACTCAGCCCCCAGCTCCAAGTGAGGCCCTTCCTCATCTCCATGCTC
TTTCTCGAGCGGAAGGGCGAATTCAGATCTGGTACCGATATCAAGCTTGTCGACTCTAGA
TTGCGGCCGCGGTCATAGCTGTTTC
>OriGene 5' read for NM_000748 unedited
GGGGGTGTTCAGATATTTGTAAACGACTTACTATAGGGNNCGGCCGCGCAATTCCTCATA
CCAGGATAGGCAAGAAGCTGGTTTCTCCTCGCAGCCGGCTCCCTGAGGCCCAGGAACCAC
CGCGGCGGCCGGCACCACCTGGACCCAGCTCCAGGCGGGCGCGGCTTCAGCACCACGGAC
AGCGCCCCACCCGCGGCCCTCCCCCCGGCGGCGCGCTCCAGCCGGTGTAGGCGAGGCAGC
GAGCTATGCCCGCGGCATGGCCCGGCGCTGCGGCCCCGTGGCGCTGCTCCTTGGCTTCGG
CCTCCTCCGGCTGTGCTCAGGGGTGTGGGGTACGGATACAGAGGAGCGGCTGGTGGAGCA
TCTCCTGGATCCTTCCCGCTACAACAAGCTTATCCGCCCAGCCACCAATGGCTCTGAGCT
GGTGACAGTACAGCTTATGGTGTCACTGGCCCAGCTCATCAGTGTGCATGAGCGGGAGCA
GATCATGACCACCAATGTCTGGCTGACCCAGGAGTGGGAAGATTATCGCCTCACCTGGAA
GCCTGAAGAGTTTGACAACATGAAGAAAGTTCGGCTCCCTTCCAAACACATCTGGCTCCC
AGATGTGGTCCTGTACAACAATGCTGACGGCATGTACGAGGTGTCCTTCTATTCCAATGC
CGTGGTCTCCTATGATGGCAGCATCTTCTGGCTGCCGCCTGCCATCTACAAGAGCGCATG
CAAGATTGAAGTAAAGCACTTCCCATTTGACCAGCAGAACTGCACCATGAAGTTCCGTTC
GTGGACCTACGACCGCACAGAGATCGACTTGGTGCTGAAGAGTGAGGTGGCCAGCCTGGA
CGACTTCACACCTAGTGGTGAGTGGGACATCGTGGCGCTGCCGGGCCGGCGCAACGAGAA
CCCCGACGACTCTACG
>OriGene 3' read for NM_000748 unedited
CTGGGAGGCACTTCAGGCCAGAGAGATGGGAGGGTCACAGGGTGCCCCCGGGATCGTTCA
GAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGACAAGCTTGATATCGGTACCAGATC
TGAATTCGCCCTTCCGCTCGAGAAAGAGCATGGAGATGAGGAAGGGCCTCACTTGGAGCT
GGGGGCTGAGTGGTCTGAGTGGAGGAAGGTGGTGGTGGTGTAGTTCTGGAAGAGAGGCTG
CAGGAACATGCCGATGGTGCCAAAGACACAGACAAAGACAAAGATCCAGAGGAAGAGGCG
GTCGATCACCATGGCGACGTACTTCCAGTCCTCACTCACGCTCTGGTCATCGTCCTCGCT
CCGCATGTGGTCTGCGATGAAGCGCACGCCGTCCACCGCCTCCCGGAGGCCACAGCCACA
CGGCTCCCCTGAGCGCCCGGGGCCCGCCACTGGTGCAGGCTCAGCCCCGAAGGCCCCGGC
CAACCCCTGCACCGACGCGCGGTTGACGAAGCACGTGCAGGAGTCAGCCCCTGGGGCTTC
GCGGAAGAAGAGGGCTCCAGCGCCCTCGCGCTCACGCTGGCGTCGCCGCAGGCGCAAGCG
CTGACGGGCGCAATGATGGCGTGGCTGCTGCATGAAGAGCAGCGCGGGCAGCTTCTCCAG
GAAGACGACCTTCACCCATGGCGCCATGGTGTGGCTTGGTGGCCGACCGGTGGTGCACGT
TTAAGCCGCCCCACGCTGGTGACCAATGGAGAAGGTGACCAAGCCCCATGGTGGACATTG
AGGTAACTTGCCGCCCAAGCGGCACGTCCAG
Restriction Sites Please inquire     
ACCN NM_000748
Insert Size 1800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000748.1, NP_000739.1
RefSeq Size 2448 bp
RefSeq ORF 1509 bp
Locus ID 1141
UniProt ID P17787
Cytogenetics 1q21.3
Domains Neur_chan_memb, Neur_chan_LBD
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Gene Summary Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
Other products for "CHRNB2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.