CBWD3 (NM_201453) Human Untagged Clone

USD 740.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CBWD3 (NM_201453) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol CBWD3
Synonyms bA561O23.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_201453, the custom clone sequence may differ by one or more nucleotides


ATGTTACCGGCTGTTGGATCTGTGGATGAGGAAGAGGATCCTGCGGAGGAGGATTGTCCTGAATTGGTTC
CCATTGAGACGACGCAAAGCGAGGAGGAGGAAAAGTCTGGCCTCGGCGCCAAGATCCCAGTCACAATTAT
CACCGGGTATTTAGGTGCTGGGAAGACAACACTTCTGAACTATATTTTGACAGAGCAACATAGTAAAAGA
GTAGCGGTCATTTTAAATGAATCTGGGGAAGGAAGTGCGCTGGAGAAATCCTTAGCTGTCAGCCAAGGTG
GAGAGCTCTATGAAGAGTGGCTGGAACTTAGAAACGGTTGCCTCTGCTGTTCAGTGAAGGACAATGGCCT
TAGAGCTATTGAGAATTTGATGCAAAAGAAGGGGAAATTTGATGACATACTGTTAGAGACCACTGGATTA
GCAGACCCTGGTGCAGTGGCTTCTATGTTTTGGGTTGATGCTGAATTAGGGAGTGATATTTACCTTGATG
GTATCATAACTATTGTGGATTCAAAATATGGATTAAAACATTTAACAGAAGAGAAACCTGATGGCCTTAT
CAATGAAGCTACTAGGCAAGTTGCTTTGGCAGATATCATTCTCATTAATAAAACAGACTTGGTTCCAGAA
GAAGATGTAAAGAAATTAAGAACGACAATTAGATCCATAAATGGACTAGGACAAATCTTAGAAACACAAA
GATCAAGAGTTGATCTCTCTAATGTATTAGATCTTCATGCCTTTGATAGTCTCTCTGGAATAAGTTTGCA
GAAAAAACTTCAGCATGTGCCAGGAACACAACCTCACCTTGATCAGAGTATTGTTACAATCACATTTGAA
GTACCAGGAAATGCAAAGGAAGAACATCTTAATATGTTTATTCAGAATCTTCTGTGGGAAAAGAATGTGA
GAAACAAGGACAATCACTGCATGGAGGTCATAAGGCTGAAGGGATTGGTGTCAATCAAAGACAAATCACA
ACAAGTGATTGTCCAGGGTGTCCATGAGCTCTATGATCTGGAGGAGACTCCAGTGAGCTGGAAGGATGAC
ACTGAGAGAACAAATCGATTGGTCCTCATTGGCAGAAATTTAGATAAGGATATCCTTAAACAGCTGTTTA
TAGCTACTGTGACAGAAACAGAAAAGCAGTGGACAACACATTTCAAAGAAGATCAAGTTTGTACATAA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_201453
ORF Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_201453.3, NP_958861
RefSeq Size 1723
RefSeq ORF 1188
Locus ID 445571
Cytogenetics 9q21.11

Other Versions

Other products for "CBWD3"
Frequently bought together (2)
Rabbit Polyclonal Anti-CBWD3 Antibody
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones