MITF (NM_198177) Human Untagged Clone

CAT#: SC307639

MITF (untagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 2

USD 804


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MITF (NM_198177) Human Untagged Clone
Symbol MITF
Synonyms bHLHe32; CMM8; MI; WS2; WS2A
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_198177 edited
CTATAGGGCGGCCGCGAATTCGCCATGGAGGCGCTTAGAGTTCAGATGTTCATGCCATGC
TCCTTTGAAAGCTTGTATCTCAGTTCCGCCGAGCATCCTGGGGCCTCCAAGCCTCCGATA
AGCTCCTCCAGTATGACATCACGCATCTTGCTACGCCAGCAACTCATGCGTGAGCAGATG
CAGGAGCAGGAGCGCAGGGAGCAGCAGCAGAAGCTGCAGGCGGCCCAGTTCATGCAACAG
AGAGTGCCCGTGAGTCAGACACCAGCCATAAACGTCAGTGTGCCCACCACCCTTCCCTCT
GCCACGCAGGTGCCGATGGAAGTCCTTAAGGTGCAGACCCACCTCGAAAACCCCACCAAG
TACCACATACAGCAAGCCCAACGGCAGCAGGTAAAGCAGTACCTTTCTACCACTTTAGCA
AATAAACATGCCAACCAAGTCCTGAGCTTGCCATGTCCAAACCAGCCTGGCGATCATGTC
ATGCCACCGGTGCCGGGGAGCAGCGCACCCAACAGCCCCATGGCTATGCTTACGCTTAAC
TCCAACTGTGAAAAAGAGGGATTTTATAAGTTTGAAGAGCAAAACAGGGCAGAGAGCGAG
TGCCCAGGCATGAACACACATTCACGAGCGTCCTGTATGCAGATGGATGATGTAATCGAT
GACATCATTAGCCTAGAATCAAGTTATAATGAGGAAATCTTGGGCTTGATGGATCCTGCT
TTGCAAATGGCAAATACGTTGCCTGTCTCGGGAAACTTGATTGATCTTTATGGAAACCAA
GGTCTGCCCCCACCAGGCCTCACCATCAGCAACTCCTGTCCAGCCAACCTTCCCAACATA
AAAAGGGAGCTCACAGAGTCTGAAGCAAGAGCACTGGCCAAAGAGAGGCAGAAAAAGGAC
AATCACAACCTGATTGAACGAAGAAGAAGATTTAACATAAATGACCGCATTAAAGAACTA
GGTACTTTGATTCCCAAGTCAAATGATCCAGACATGCGCTGGAACAAGGGAACCATCTTA
AAAGCATCCGTGGACTATATCCGAAAGTTGCAACGAGAACAGCAACGCGCAAAAGAACTT
GAAAACCGACAGAAGAAACTGGAGCACGCCAACCGGCATTTGTTGCTCAGAATACAGGAA
CTTGAAATGCAGGCTCGAGCTCATGGACTTTCCCTTATTCCATCCACGGGTCTCTGCTCT
CCAGATTTGGTGAATCGGATCATCAAGCAAGAACCCGTTCTTGAGAACTGCAGCCAAGAC
CTCCTTCAGCATCATGCAGACCTAACCTGTACAACAACTCTCGATCTCACGGATGGCACC
ATCACCTTCAACAACAACCTCGGAACTGGGACTGAGGCCAACCAAGCCTATAGTGTCCCC
ACAAAAATGGGATCCAAACTGGAAGACATCCTGATGGACGACACCCTTTCTCCCGTCGGT
GTCACTGATCCACTCCTTTCCTCAGTGTCCCCCGGAGCTTCCAAAACAAGCAGCCGGAGG
AGCAGTATGAGCATGGAAGAGACGGAGCACACTTGTTAGCGAATCCTCCCTGCACTGCAT
TCGCACAAACTGCTTCCTTTCTTGATT
Tag Tag Free
ACCN NM_198177
ORF Size 1515 bp
Insert Size 1600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_198177.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_198177.1, NP_937820
RefSeq Size 4624
RefSeq ORF 1515
Locus ID 4286
Cytogenetics 3p13
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Melanogenesis, Pathways in cancer, Melanoma
Gene Summary This gene encodes a transcription factor that contains both basic helix-loop-helix and leucine zipper structural features. It regulates the differentiation and development of melanocytes retinal pigment epithelium and is also responsible for pigment cell-specific transcription of the melanogenesis enzyme genes. Heterozygous mutations in the this gene cause auditory-pigmentary syndromes, such as Waardenburg syndrome type 2 and Tietz syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (2), also known as isoform MITF-H, has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations