BHLHA15 (NM_177455) Human Untagged Clone

CAT#: SC307095

BHLHA15 (untagged)-Human basic helix-loop-helix family, member a15 (BHLHA15)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BHLHA15
• Synonyms: BHLHB8; MIST1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_177455 edited
  AGCTCCAAGGGCCTCACCTTCCTGCCGCCACCTCCTAGGACAGCCAGTCCAGGGCCATGA
  AGACCAAGAACCGGCCCCCACGGCGCCGGGCCCCGGTGCAGGACACAGAGGCCACCCCCG
  GGGAGGGGACGCCCGACGGGTCCCTGCCGAACCCGGGGCCAGAGCCGGCCAAGGGTCTGC
  GGAGCCGGCCGGCCCGGGCCGCAGCAAGGGCTCCGGGCGAGGGCAGGCGCAGGCGGCCAG
  GACCCTCCGGGCCCGGTGGCCGTCGTGACAGCAGCATCCAGCGGCGGCTGGAGAGCAACG
  AGAGGGAGCGGCAGCGGATGCACAAGCTAAATAACGCCTTCCAGGCCCTGCGTGAAGTCA
  TCCCCCACGTGCGCGCGGACAAGAAGCTCTCCAAGATCGAGACGCTCACGCTGGCCAAGA
  ACTACATCAAATCGCTGACGGCCACCATCCTGACCATGTCCAGCAGCCGCCTCCCAGGCC
  TGGAGGGGCCGGGCCCCAAGCTCTACCAGCACTACCAGCAGCAGCAGCAGGTGGCTGGGG
  GTGCGTTGGGGGCCACGGAGGCCCAGCCCCAGGGCCACCTGCAGAGGTACTCCACGCAGA
  TCCACAGCTTCCGAGAGGGCACCTAGCGCCCAGTCCTGGGTGGGGGTGGCGGTGGCCGCA
  GCTGCCTGGCCTGCTCCTCCCAGCCCCAGTCCCTCCAAGCCACGAG
  
• Restriction Sites: Please inquire
• ACCN: NM_177455
• Insert Size: 700 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_177455.2.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_177455.2, NP_803238.1
• RefSeq Size: 588 bp
• RefSeq ORF: 570 bp
• Locus ID: 168620
• UniProt ID: Q7RTS1
• Cytogenetics: 7q21.3
• Protein Pathways: Maturity onset diabetes of the young
• Gene Summary: Plays a role in controlling the transcriptional activity of MYOD1, ensuring that expanding myoblast populations remain undifferentiated. Repression may occur through muscle-specific E-box occupancy by homodimers. May also negatively regulate bHLH-mediated transcription through an N-terminal repressor domain. Serves as a key regulator of acinar cell function, stability, and identity. Also required for normal organelle localization in exocrine cells and for mitochondrial calcium ion transport. May function as a unique regulator of gene expression in several different embryonic and postnatal cell lineages. Binds to the E-box consensus sequence 5'-CANNTG-3' (By similarity).[UniProtKB/Swiss-Prot Function]