KChIP2 (KCNIP2) (NM_173194) Human Untagged Clone
CAT#: SC306797
KCNIP2 (untagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 5
"NM_173194" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNIP2 |
Synonyms | KCHIP2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_173194, the custom clone sequence may differ by one or more nucleotides
ATGAACCGATGCCCCCGCAGGTGCCGGAGCCCGCTGGGGCAGGCAGCGCGATCCCTCTAC CAGCTGGTGACTGGGTCGCTGTCCCCAGACAGCGTGGACGATGAATTTGAATTGTCCACC GTGTGTCACCGGCCTGAGGGTCTGGAGCAGCTGCAGGAGCAAACCAAATTCACGCGCAAG GAGTTGCAGGTCCTGTACCGGGGCTTCAAGAACGAATGTCCCAGCGGAATTGTCAATGAG GAGAACTTCAAGCAGATTTACTCCCAGTTCTTTCCTCAAGGAGACTCCAGCACCTATGCC ACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCGGTCAGTTTTGAGGACTTT GTGGCTGGTTTGTCCGTGATTCTTCGGGGAACTGTAGATGACAGGCTTAATTGGGCCTTC AACCTGTATGACCTTAACAAGGACGGCTGCATCACCAAGGAGGAAATGCTTGACATCATG AAGTCCATCTATGACATGATGGGCAAGTACACGTACCCTGCACTCCGGGAGGAGGCCCCA AGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGACAGAAACAAGGATGGTGTGGTGACC ATTGAGGAATTCATTGAGTCTTGTCAAAAGGATGAGAACATCATGAGGTCCATGCAGCTC TTTGACAATGTCATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_173194 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173194.2, NP_775286.1 |
RefSeq Size | 2090 bp |
RefSeq ORF | 678 bp |
Locus ID | 30819 |
UniProt ID | Q9NS61 |
Cytogenetics | 10q24.32 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) has a shorter and alternate 5' sequence including the 5' UTR and the 5' coding region, as compared to variant 1. Isoform 5 is shorter and has a distinct N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212601 | KCNIP2 (Myc-DDK-tagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 5 |
USD 330.00 |
|
RC212601L3 | Lenti-ORF clone of KCNIP2 (Myc-DDK-tagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 5 |
USD 630.00 |
|
RC212601L4 | Lenti-ORF clone of KCNIP2 (mGFP-tagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 5 |
USD 630.00 |
|
RG212601 | KCNIP2 (tGFP-tagged) - Human Kv channel interacting protein 2 (KCNIP2), transcript variant 5 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review