Kv beta 1 (KCNAB1) (NM_172160) Human Untagged Clone

CAT#: SC306728

Reviews ()
Write a review

KCNAB1 (untagged)-Human potassium voltage-gated channel, shaker-related subfamily, beta member 1 (KCNAB1), transcript variant 1


  View "NM_172160" in other vectors (6)

USD 710.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kv beta 1 (KCNAB1) (NM_172160) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol KCNAB1
Synonyms AKR6A3; hKvb3; hKvBeta3; KCNA1B; KV-BETA-1; Kvb1.3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_172160, the custom clone sequence may differ by one or more nucleotides


ATGCTGGCAGCCCGGACAGGGGCAGCGGGGAGTCAGATCTCAGAGGAGAACACCAAGTTAAGGAGACAGT
CTGGGTTTTCTGTAGCAGGGAAAGACAAATCTCCCAAGAAAGCCTCAGAAAACGCTAAAGACAGCAGCCT
TAGTCCCTCAGGGGAAAGCCAGCTCAGGGCGCGTCAACTGGCTCTGCTGCGCGAAGTGGAGATGAACTGG
TACCTAAAGCTCTGCGACCTGTCCAGCGAGCACACCACCGTCTGCACCACAGGCATGCCGCACAGGAATC
TTGGAAAATCAGGACTCAGAGTTTCTTGCTTGGGTCTTGGAACATGGGTGACATTTGGAGGTCAAATTTC
AGATGAGGTTGCTGAACGGCTGATGACCATCGCCTATGAAAGTGGTGTTAACCTCTTTGATACTGCCGAA
GTCTATGCTGCTGGAAAGGCTGAAGTGATTCTGGGGAGCATCATCAAGAAGAAAGGCTGGAGGAGGTCCA
GTCTGGTCATAACAACCAAACTCTACTGGGGTGGAAAAGCTGAAACAGAAAGAGGGCTGTCAAGAAAGCA
TATTATTGAAGGATTGAAGGGCTCCCTCCAGAGGCTGCAGCTCGAGTATGTGGATGTGGTCTTTGCAAAT
CGACCGGACAGTAACACTCCCATGGAAGAAATTGTCCGAGCCATGACACATGTGATAAACCAAGGCATGG
CGATGTACTGGGGCACCTCGAGATGGAGTGCTATGGAGATCATGGAAGCCTATTCTGTAGCAAGACAGTT
CAATATGATCCCACCGGTCTGTGAACAAGCTGAGTACCATCTTTTCCAGAGAGAGAAAGTGGAGGTCCAG
CTGCCAGAGCTCTACCACAAAATAGGTGTTGGCGCAATGACATGGTCTCCACTTGCCTGTGGAATCATCT
CAGGAAAATACGGAAACGGGGTGCCTGAAAGTTCCAGGGCTTCACTGAAGTGCTACCAGTGGTTGAAAGA
AAGAATTGTAAGTGAAGAAGGGAGAAAACAGCAAAACAAGCTAAAAGACCTTTCCCCAATTGCGGAGCGT
CTGGGATGCACACTACCTCAGCTAGCTGTTGCGTGGTGCCTGAGAAATGAAGGTGTGAGTTCTGTGCTCC
TGGGATCATCCACTCCTGAACAACTCATTGAAAACCTTGGTGCCATTCAGGTTCTCCCAAAGATGACATC
ACATGTGGTAAATGAGATTGATAACATACTGCGCAACAAGCCCTACAGCAAGAAGGACTATAGATCATAA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_172160
ORF Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172160.2, NP_751892.1
RefSeq Size 3715
RefSeq ORF 1260
Locus ID 7881
Cytogenetics 3q25.31
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) encodes the longest isoform (1), which is also known as kvb1.1.

Other Versions

Other products for "KCNAB1"
Frequently bought together (2)
KCNAB1 (Kv beta 1) mouse monoclonal antibody, clone OTI7F12 (formerly 7F12)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones