IL29 (IFNL1) (NM_172140) Human Untagged Clone

CAT#: SC306727

Reviews ()
Write a review

IFNL1 (untagged)-Human interleukin 29 (interferon, lambda 1) (IL29)



  "NM_172140" in other vectors (6)

USD 433.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name IL29 (IFNL1) (NM_172140) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol IFNL1
Synonyms IL-29; IL29
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_172140 edited
TAAAAAGCAGAGCCATGCCGCTGGGGAAGCAGTTGCGATTTAGCCATGGCTGCAGCTTGG
ACCGTGGTGCTGGTGACTTTGGTGCTAGGCTTGGCCGTGGCAGGCCCTGTCCCCACTTCC
AAGCCCACCACAACTGGGAAGGGCTGCCACATTGGCAGGTTCAAATCTCTGTCACCACAG
GAGCTAGCGAGCTTCAAGAAGGCCAGGGACGCCTTGGAAGAGTCACTCAAGCTGAAAAAC
TGGAGTTGCAGCTCTCCTGTCTTCCCCGGGAATTGGGACCTGAGGCTTCTCCAGGTGAGG
GAGCGCCCTGTGGCCTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTCCTGGAGGCCGCT
GCTGGCCCAGCCCTGGAGGACGTCCTAGACCAGCCCCTTCACACCCTGCACCACATCCTC
TCCCAGCTCCAGGCCTGTATCCAGCCTCAGCCCACAGCAGGGCCCAGGCCCCGGGGCCGC
CTCCACCACTGGCTGCACCGGCTCCAGGAGGCCCCCAAAAAGGAGTCCGCTGGCTGCCTG
GAGGCATCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTCAAATATGTGGCC
GATGGGAACCTGTGTCTGAGAACGTCAACCCACCCTGAGTCCACCTGACACCCCACACCT
TATTTATGCGCTGAGCCCTACTCCT
Restriction Sites Please inquire     
ACCN NM_172140
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172140.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172140.1, NP_742152.1
RefSeq Size 856 bp
RefSeq ORF 603 bp
Locus ID 282618
Cytogenetics 19q13.2
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 28B (IL28B) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]

Other Versions

Other products for "IFNL1"
Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00


IFNL1 mouse monoclonal antibody,clone OTI9D3
    • 100 ul

USD 379.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools