BDNF (NM_170734) Human Untagged Clone

CAT#: SC306691

Reviews ()
Write a review

BDNF (untagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 6



  "NM_170734" in other vectors (6)

USD 462.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BDNF
Synonyms ANON2; BULN2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_170734 edited
ATGCAGAGCCGGGAAGAGGAATGGTTCCACCAGGTGAGAAGAGTGATGACCATCCTTTTC
CTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCCATGAAAGAAGCAAAC
ATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCATGGGACTCTGGAGAGC
GTGAATGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCTGACACTTTCGAACAC
GTGATAGAAGAGCTGTTGGATGAGGACCAGAAAGTTCGGCCCAATGAAGAAAACAATAAG
GACGCAGACTTGTACACGTCCAGGGTGATGCTCAGTAGTCAAGTGCCTTTGGAGCCTCCT
CTTCTCTTTCTGCTGGAGGAATACAAAAATTACCTAGATGCTGCAAACATGTCCATGAGG
GTCCGGCGCCACTCTGACCCTGCCCGCCGAGGGGAGCTGAGCGTGTGTGACAGTATTAGT
GAGTGGGTAACGGCGGCAGACAAAAAGACTGCAGTGGACATGTCGGGCGGGACGGTCACA
GTCCTTGAAAAGGTCCCTGTATCAAAAGGCCAACTGAAGCAATACTTCTACGAGACCAAG
TGCAATCCCATGGGTTACACAAAAGAAGGCTGCAGGGGCATAGACAAAAGGCATTGGAAC
TCCCAGTGCCGAACTACCCAGTCGTACGTGCGGGCCCTTACCATGGATAGCAAAAAGAGA
ATTGGCTGGCGATTCATAAGGATAGACACTTCTTGTGTATGTACATTGACCATTAAAAGG
GGAAGATAGTGGATTTATGTTGTATAGATTAGATTATATTGAGACAAAAATTATCTATTT
GTATATATACATAACAGGGTAAATTATTCAGTTAAGAAAAAAATAATTTTATGAACTGCA
TGTATAAATGAAGTTTATACAGTACAGTGGTTCTACAATCTATTTATTGGACATGTCCAT
GACCAGAAGGGAAACAGTCATTTGCGCACAACTTAAAAAGTCTGCATTACATTCCTTGAT
AATGTTGTGGTTTGTTGCCGTTGCCAAGAACTGAAAACATAAAAAGTTAAAAAAAATAAT
AAATTGCATGCTGCTTTAATTGTGAATTGAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_170734 unedited
GTTCAGTTCACATTTGTATACGACTCATATAGGCGGCCGCGNATTCATGCAGAGCCGGGA
AGAGGAATGGTTCCACCAGGTGAGAAGAGTGATGACCATCCTTTTCCTTACTATGGTTAT
TTCATACTTTGGTTGCATGAAGGCTGCCCCCATGAAAGAAGCAAACATCCGAGGACAAGG
TGGCTTGGCCTACCCAGGTGTGCGGACCCATGGGACTCTGGAGAGCGTGAATGGGCCCAA
GGCAGGTTCAAGAGGCTTGACATCATTGGCTGACACTTTCGAACACGTGATAGAAGAGCT
GTTGGATGAGGACCAGAAAGTTCGGCCCAATGAAGAAAACAATAAGGACGCAGACTTGTA
CACGTCCAGGGTGATGCTCAGTAGTCAAGTGCCTTTGGAGCCTCCTCTTCTCTTTCTGCT
GGAGGAATACAAAAATTACCTAGATGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTC
TGACCCTGCCCGCCGAGGGGAGCTGAGCGTGTGTGACAGTATTAGTGAGTGGGTAACGGC
GGCAGACAAAAAGACTGCAGTGGACATGTCGGGCGGGACGGTCACAGTCCTTGAAAAGGT
CCCTGTATCAAAAGGCCAACTGAAGCAATACTTCTACGAGACCAAGTGCAATCCCATGGG
TTACACAAAAGAAAGCTGCAGGGGCATAGACAAAAGGCATTGGAACTCCCAGTGCCGAAC
TACCCAGTCGTACGTGCGGGCCCTTACCATGGATAGCANNAAGAAATTGGCTGGCGATTC
ATAAGGATAGACACTTCTTGTGTATGTACATTGACCATTAAAGGGGGAGATAGTGGNATT
ATGTN
>Forward primer walk for NM_170734 unedited
GATCAGTAGGATTGTGNNACCCTGTACTGTATAAACTTCATTTATACATGCAGTTCATAA
AATATTTTTTTCTTAACTGAATAATTTACCCTGTTATGTATATATACAAATAGATAATTT
TTGTCTCAATATAATCTAATCTATACAACATAAATCCACTATCTTCCCCTTTTAATGGTC
AATGTACATACACAAGAAGTGTCTATCCTTATGAATCGCCAGCCAATTCTCTTTTTGCTA
TCCATGGTAAGGGCCCGCACGTACGACTGGGTAGTTCGGCACTGGGAGTTCCAATGCCTT
TTGTCTATGCCCCTGCAGCCTTCTTTTGTGTAACCCATGGGATTGCACTTGGTCTCGTAG
AAGTATTGCTTCAGTTGGCCTTTTGATACAGGGACCTTTTCAAGGACTGTGACCGTCCCG
CCCGACATGTCCACTGCAGTCTTTTTGTCTGCCGCCGTTACCCACTCACTAATACTGTCA
CACACGCTCAGCTCCCCTCGGCGGGCAAGGTCAAAGTGGCGCCAGACCCCTCTGGACATG
TTTGCAACATCTAAGAAATTTTTGAATCCCCCACCAAAAAAAAGAAAAGAAGCTCCAAAA
GCACTTGACTACTGGACCACACCCTAGGACAGGTAAAAAGTCTGCCACCCTAATGGTTAT
CTAACAAGGGACCCAAATTTTCTGGACCCCCAAACAAAAAACTCTTAGTATAAACGTTTA
AAAAAAGGAGTAACCCCAATGGAGTCCAGACCTCATGGAAAACAGCCGTGGGGAGAAAAA
TAAAGAAACACACAAAACACCAAAAGAGACCCCACAAACGTGGTTAGAGAAAAAAAACCC
AAGGGACCGGAAAGGATACCCATAGTCTCAAGCGACACAAACCACAAAAGGCACACAAAA
GAGAGGAGAACAAACAGTAGAAANAAGAGAAGATGTAGGAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_170734
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_170734.2, NP_733930.1
RefSeq Size 3958 bp
RefSeq ORF 789 bp
Locus ID 627
UniProt ID P23560
Cytogenetics 11p14.1
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Transmembrane
Protein Pathways Huntington's disease, MAPK signaling pathway, Neurotrophin signaling pathway
Gene Summary This gene encodes a member of the nerve growth factor family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. Binding of this protein to its cognate receptor promotes neuronal survival in the adult brain. Expression of this gene is reduced in Alzheimer's, Parkinson's, and Huntington's disease patients. This gene may play a role in the regulation of the stress response and in the biology of mood disorders. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (6), also known as VIIb, BDNF6B, or 4I-5, represents use of an alternate promoter and differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (c) contains a longer N-terminus and lacks a predicted signal peptide compared to isoform a.

Other Versions

Other products for "BDNF"
Frequently bought together (4)
Rabbit Polyclonal Anti-BDNF
    • 200 ul

USD 760.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.