FGF 23 (FGF23) (NM_020638) Human Untagged Clone

CAT#: SC304789

FGF23 (untagged)-Human fibroblast growth factor 23 (FGF23)


  "NM_020638" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
FGF23 Rabbit monoclonal antibody,clone OTIR5D11
    • 100 ul

USD 428.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "FGF 23"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FGF 23
Synonyms ADHR; FGFN; HFTC2; HPDR2; HYPF; PHPTC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_020638 edited
GGTTTCAATCTCAGCACCAGCCACTCAGAGCAGGGCACGATGTTGGGGGCCCGCCTCAGG
CTCTGGGTCTGTGCCTTGTGCAGCGTCTGCAGCATGAGCGTCCTCAGAGCCTATCCCAAT
GCCTCCCCACTGCTCGGCTCCAGCTGGGGTGGCCTGATCCACCTGTACACAGCCACAGCC
AGGAACAGCTACCACCTGCAGATCCACAAGAATGGCCATGTGGATGGCGCACCCCATCAG
ACCATCTACAGTGCCCTGATGATCAGATCAGAGGATGCTGGCTTTGTGGTGATTACAGGT
GTGATGAGCAGAAGATACCTCTGCATGGATTTCAGAGGCAACATTTTTGGATCACACTAT
TTCGACCCGGAGAACTGCAGGTTCCAACACCAGACGCTGGAAAACGGGTACGACGTCTAC
CACTCTCCTCAGTATCACTTCCTGGTCAGTCTGGGCCGGGCGAAGAGAGCCTTCCTGCCA
GGCATGAACCCACCCCCGTACTCCCAGTTCCTGTCCCGGAGGAACGAGATCCCCCTAATT
CACTTCAACACCCCCATACCACGGCGGCACACCCGGAGCGCCGAGGACGACTCGGAGCGG
GACCCCCTGAACGTGCTGAAGCCCCGGGCCCGGATGACCCCGGCCCCGGCCTCCTGTTCA
CAGGAGCTCCCGAGCGCCGAGGACAACAGCCCGATGGCCAGTGACCCATTAGGGGTGGTC
AGGGGCGGTCGAGTGAACACGCACGCTGGGGGAACGGGCCCGGAAGGCTGCCGCCCCTTC
GCCAAGTTCATCTAGGGTCGCTGGAAGGGCACCCTCTTTAACCCATCCCTCAGCAAACGC
AGCTCTTCCCAAGGACCAGGTCCCTTGACGTTCCGAGGATGGGAAAGGTGACAGGG
>OriGene 5' read for NM_020638 unedited
GTCAGCATTTGTATACGACTCATATAGGCGGCCGCCAGTGTGATGGATATCTGCAGAATT
CGCCCTTCACCGGTTTCAATCTCAGCACCAGCCACTCAGAGCAGGGCACGATGTTGGGGG
CCCGCCTCAGGCTCTGGGTCTGTGCCTTGTGCAGCGTCTGCAGCATGAGCGTCCTCAGAG
CCTATCCCAATGCCTCCCCACTGCTCGGCTCCAGCTGGGGTGGCCTGATCCACCTGTACA
CAGCCACAGCCAGGAACAGCTACCACCTGCAGATCCACAAGAATGGCCATGTGGATGGCG
CACCCCATCAGACCATCTACAGTGCCCTGATGATCAGATCAGAGGATGCTGGCTTTGTGG
TGATTACAGGTGTGATGAGCAGAAGATACCTCTGCATGGATTTCAGAGGCAACATTTTTG
GATCACACTATTTCGACCCGGAGAACTGCAGGTTCCAACACCAGACGCTGGAAAACGGGT
ACGACGTCTACCACTCTCCTCAGTATCACTTCCTGGTCAGTCTGGGCCGGGCGAAGAGAG
CCTTCCTGCCAGGCATGAACCCACCCNCGTACTCCCAGTTCCTGTCCCGGAGGAACGAGA
TCCCCCTAATTCACTTCAACACCCCCATACCACGGCGGCACACCCGGAGCGCCGAGGACG
ACTNCGAGCGGGACCCCCTGAACGTGCTGAAGCCCCGGGCCCGNATGACCCCGGCCCCCG
CCTCCTGTTCACAGGAGCTCCCGAGCGCCGAGGACCACAGCCCGATGGCCAGTGACCCAT
TAGGGGTGGTCAGGGGCNGTCGAGTGAACACGCACGCTGGGGGAACCGGCCCCGNAAGCT
GCCC
Restriction Sites Please inquire     
ACCN NM_020638
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020638.2, NP_065689.1
RefSeq Size 3018 bp
RefSeq ORF 756 bp
Locus ID 8074
UniProt ID Q9GZV9
Cytogenetics 12p13.32
Protein Families Druggable Genome, Secreted Protein
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC). [provided by RefSeq, Feb 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.