H3FC (HIST1H3C) (NM_003531) Human Untagged Clone

SKU
SC303327
HIST1H3C (untagged)-Human histone cluster 1, H3c (HIST1H3C)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol H3FC
Synonyms H3.1; H3/c; H3C1; H3C2; H3C4; H3C6; H3C7; H3C8; H3C10; H3C11; H3C12; H3FC; HIST1H3C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303327 representing NM_003531.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCGTACGAAGCAAACAGCTCGCAAGTCTACCGGCGGCAAAGCTCCGCGCAAGCAGCTTGCTACT
AAAGCAGCCCGTAAGAGCGCTCCGGCCACCGGTGGCGTGAAGAAACCTCATCGCTACCGCCCGGGCACC
GTGGCCTTGCGCGAAATCCGTCGCTACCAGAAGTCCACCGAGCTGCTGATCCGGAAGCTGCCGTTCCAG
CGCCTGGTGCGAGAAATCGCCCAGGACTTCAAAACCGACCTGCGTTTCCAGAGCTCTGCGGTGATGGCG
CTGCAGGAGGCTTGTGAGGCCTACCTGGTGGGACTCTTCGAAGACACCAATCTGTGCGCTATTCACGCT
AAACGCGTCACCATCATGCCCAAAGATATCCAGCTGGCACGTCGCATCCGTGGGGAAAGGGCATAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII
ACCN NM_003531
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003531.2
RefSeq Size 459 bp
RefSeq ORF 411 bp
Locus ID 8352
UniProt ID P68431
Cytogenetics 6p22.2
Protein Pathways Systemic lupus erythematosus
MW 15.4 kDa
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]
Write Your Own Review
You're reviewing:H3FC (HIST1H3C) (NM_003531) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214815 HIST1H3C (Myc-DDK-tagged)-Human histone cluster 1, H3c (HIST1H3C) 10 ug
$150.00
RC214815L3 Lenti ORF clone of Human histone cluster 1, H3c (HIST1H3C), Myc-DDK-tagged 10 ug
$450.00
RC214815L4 Lenti ORF clone of Human histone cluster 1, H3c (HIST1H3C), mGFP tagged 10 ug
$450.00
RG214815 HIST1H3C (tGFP-tagged) - Human histone cluster 1, H3c (HIST1H3C) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.