RSPO1 (NM_001038633) Human Untagged Clone

CAT#: SC302953

RSPO1 (untagged)-Human R-spondin homolog (Xenopus laevis) (RSPO1)

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RSPO1 (NM_001038633) Human Untagged Clone
Symbol RSPO1
Synonyms CRISTIN3; RSPO
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001038633 edited
GTTAGCAAGAGCCGTGTGCTATCCACCCTCCCCGAGACCACCCCTCCGACCAGGGGCCTG
GAGCTGGCGCGTGACTATGCGGCTTGGGCTGTGTGTGGTGGCCCTGGTTCTGAGCTGGAC
GCACCTCACCATCAGCAGCCGGGGGATCAAGGGGAAAAGGCAGAGGCGGATCAGTGCCGA
GGGGAGCCAGGCCTGTGCCAAAGGCTGTGAGCTCTGCTCTGAAGTCAACGGCTGCCTCAA
GTGCTCACCCAAGCTGTTCATCCTGCTGGAGAGGAACGACATCCGCCAGGTGGGCGTCTG
CTTGCCGTCCTGCCCACCTGGATACTTCGACGCCCGCAACCCCGACATGAACAAGTGCAT
CAAATGCAAGATCGAGCACTGTGAGGCCTGCTTCAGCCATAACTTCTGCACCAAGTGTAA
GGAGGGCTTGTACCTGCACAAGGGCCGCTGCTATCCAGCTTGTCCCGAGGGCTCCTCAGC
TGCCAATGGCACCATGGAGTGCAGTAGTCCTGCGCAATGTGAAATGAGCGAGTGGTCTCC
GTGGGGGCCCTGCTCCAAGAAGCAGCAGCTCTGTGGTTTCCGGAGGGGCTCCGAGGAGCG
GACACGCAGGGTGCTACATGCCCCTGTGGGGGACCATGCTGCCTGCTCTGACACCAAGGA
GACCCGGAGGTGCACAGTGAGGAGAGTGCCGTGTCCTGAGGGGCAGAAGAGGAGGAAGGG
AGGCCAGGGCCGGCGGGAGAATGCCAACAGGAACCTGGCCAGGAAGGAGAGCAAGGAGGC
GGGTGCTGGCTCTCGAAGACGCAAGGGGCAGCAACAGCAGCAGCAGCAAGGGACAGTGGG
GCCACTCACATCTGCAGGGCCTGCCTAGGGACACTGTCCAGCCTCCAGGCCCATGCAGAA
AGAGTTCAGTGCTACTCTGCGTGATTCAAGCTTTCCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001038633 unedited
NGGGGAAGTTCACATTTGTATACGACTCATATAGGGCGGCCGCGATTCGCCCCANAGTGT
TAGCAAGAGCCGTGTGCTATCCACCCTCCCCGANACCACCCCTCCGACCAGGGGCCTGGA
GCTGGCGCGTGACTATGCGGCTTGGGCTGTGTGTGGTGGCCCTGGTTCTGAGCTGGACGC
ACCTCACCATCAGCAGCCGGGGGATCAAGGGGAAAAGGCAGAGGCGGATCAGTGCCGAGG
GGAGCCAGGCCTGTGCCAAAGGCTGTGAGCTCTGCTCTGAAGTCAACGGCTGCCTCAAGT
GCTCACCCAAGCTGTTCATCCTGCTGGAGAGGAACGACATCCGCCAGGTGGGCGTCTGCT
TGCCGTCCTGCCCACCTGGATACTTCGACGCCCGCAACCCCGACATGAACAAGTGCATCA
AATGCAAGATCGAGCACTGTGAGGCCTGCTTCAGCCATAACTTCTGCACCAAGTGTAAGG
AGGGCTTGTACCTGCACAAGGGCCGCTGCTATCCAGCTTGTCCCGAGGGCTCCTCAGCTG
CCAATGGCACCATGGAGTGCAGTAGTCCTGCGCAATGTGAAATGAGCGAGTGGTCTCCGT
GGGGGCCCTGCTCCAAGAAGCAGCAGCTCTGTGGTTTCCGGAGGGGCTCCGAGGAGCGGA
CACGCAGGGTGCTACATGCCCCTGTGGGGGACCATGCTGCCTGCTCTGACACCAAGAACC
CCGGAGGTGCACAGTGAGGGGAGAGTGCCGTGTCCTGAGGGGGCANAAAGGNAGGAAAAG
GAGGGCCAGGGCCCGGNCGGGAGAATGCCAACAGGAACCTGGCCAGNNAAGANAGCAGGA
NGGCCGNNTGCTGGCTCTCGAGAACGCAGGGGGCAGCAACAGCAGCAGN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001038633 unedited
NGGGCCCATTGGNGAATGGCACTTCCCAGGNCCAGNANGAGCCTGGGGNAGGGTCACAGG
GNAGCCACCCGGGATCTGTTCAGGAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGT
CAGGAAAGCTTGAATCACGCAGAGTAGCACTGAACTCTTTCTGCATGGGCCTGGAGGCTG
GACAGTGTCCCTAGGCAGGCCCTGCAGATGTGAGTGGCCCCACTGTCCCTTGCTGCTGCT
GCTGTTGCTGCCCCTTGCGTCTTCGAGAGCCAGCACCCGCCTCCTTGCTCTCCTTCCTGG
CCAGGTTCCTGTTGGCATTCTCCCGCCGGCCCTGGCCTCCCTTCCTCCTCTTCTGCCCCT
CAGGACACGGCACTCTCCTCACTGTGCACCTCCGGGTCTCCTTGGTGTCAGAGCAGGCAG
CATGGTCCCCCACAGGGGCATGTAGCACCCTGCGTGTCCGCTCCTCGGAGCCCCTCCGGA
AACCACAGAGCTGCTGCTTCTTGGAGCAGGGCCCCCACGGAGACCACTCGCTCATTTCAC
ATTGCGCAGGACTACTGCACTCCATGGTGCCATTGGCAGCTGAGGAGCCCTCGGGACAAG
CTGGATAGCAGCGGCCCTTGTGCAGGTACAAGCCCTCCTTACACTTGGTGNCAGAAGTTA
TGGCTGAAGCAGGCCTCACAGTGCTCGATCTTGCATTTGATGCACTTGTTCATGTTTCGG
GTTTGCGGCGGTTCGAAGTATCCCAGGTGGGCAGGACGGCAAGCAGACGCCCACCTGNNC
GGATGTCGTTCCTCNTCCAGCAGATGAACAGCCTNGGGTGAGCACTTGAGGCAGCCGNTG
ACTTCAGAGCAGAGCTCACAGNCTTTGGCACAGGCCTGGCTCCCCTCGGNACTGATCCGG
CTCTGGCTTTTN
Tag Tag Free
ACCN NM_001038633
ORF Size 792 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001038633.2, NP_001033722
RefSeq Size 2995
RefSeq ORF 792
Locus ID 284654
Cytogenetics 1p34.3
Protein Families Secreted Protein
Gene Summary This gene encodes a secreted activator protein with two cysteine-rich, furin-like domains and one thrombospondin type 1 domain. The encoded protein is a ligand for leucine-rich repeat-containing G-protein coupled receptors (LGR proteins) and positively regulates the Wnt signaling pathway. In mice, the protein induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations