HGF (NM_001010932) Human Untagged Clone

CAT#: SC301539

HGF (untagged)-Human hepatocyte growth factor (hepapoietin A, scatter factor) (HGF), transcript variant 3

USD 1,381.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HGF (NM_001010932) Human Untagged Clone
Symbol HGF
Synonyms DFNB39; F-TCF; HGFB; HPTA; SF
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001010932 edited
AACAGGATTCTTTCACCCAGGCATCTCCTCCAGAGGGATCCGCCAGCCCGTCCAGCAGCA
CCATGTGGGTGACCAAACTCCTGCCAGCCCTGCTGCTGCAGCATGTCCTCCTGCATCTCC
TCCTGCTCCCCATCGCCATCCCCTATGCAGAGGGACAAAGGAAAAGAAGAAATACAATTC
ATGAATTCAAAAAATCAGCAAAGACTACCCTAATCAAAATAGATCCAGCACTGAAGATAA
AAACCAAAAAAGTGAATACTGCAGACCAATGTGCTAATAGATGTACTAGGAATAAAGGAC
TTCCATTCACTTGCAAGGCTTTTGTTTTTGATAAAGCAAGAAAACAATGCCTCTGGTTCC
CCTTCAATAGCATGTCAAGTGGAGTGAAAAAAGAATTTGGCCATGAATTTGACCTCTATG
AAAACAAAGACTACATTAGAAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAG
TATCTATCACTAAGAGTGGCATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAAC
ACAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAG
GGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTC
AGTGTTCAGAAGTTGAATGCATGACCTGCAATGGGGAGAGTTATCGAGGTCTCATGGATC
ATACAGAATCAGGCAAGATTTGTCAGCGCTGGGATCATCAGACACCACACCGGCACAAAT
TCTTGCCTGAAAGATATCCCGACAAGGGCTTTGATGATAATTATTGCCGCAATCCCGATG
GCCAGCCGAGGCCATGGTGCTATACTCTTGACCCTCACACCCGCTGGGAGTACTGTGCAA
TTAAAACATGCGCTGACAATACTATGAATGACACTGATGTTCCTTTGGAAACAACTGAAT
GCATCCAAGGTCAAGGAGAAGGCTACAGGGGCACTGTCAATACCATTTGGAATGGAATTC
CATGTCAGCGTTGGGATTCTCAGTATCCTCACGAGCATGACATGACTCCTGAAAATTTCA
AGTGCAAGGACCTACGAGAAAATTACTGCCGAAATCCAGATGGGTCTGAATCACCCTGGT
GTTTTACCACTGATCCAAACATCCGAGTTGGCTACTGCTCCCAAATTCCAAACTGTGATA
TGTCACATGGACAAGATTGTTATCGTGGGAATGGCAAAAATTATATGGGCAACTTATCCC
AAACAAGATCTGGACTAACATGTTCAATGTGGGACAAGAACATGGAAGACTTACATCGTC
ATATCTTCTGGGAACCAGATGCAAGTAAGCTGAATGAGAATTACTGCCGAAATCCAGATG
ATGATGCTCATGGACCCTGGTGCTACACGGGAAATCCACTCATTCCTTGGGATTATTGCC
CTATTTCTCGTTGTGAAGGTGATACCACACCTACAATAGTCAATTTAGACCATCCCGTAA
TATCTTGTGCCAAAACGAAACAATTGCGAGTTGTAAATGGGATTCCAACACGAACAAACA
TAGGATGGATGGTTAGTTTGAGATACAGAAATAAACATATCTGCGGAGGATCATTGATAA
AGGAGAGTTGGGTTCTTACTGCACGACAGTGTTTCCCTTCTCGAGACTTGAAAGATTATG
AAGCTTGGCTTGGAATTCATGATGTCCACGGAAGAGGAGATGAGAAATGCAAACAGGTTC
TCAATGTTTCCCAGCTGGTATATGGCCCTGAAGGATCAGATCTGGTTTTAATGAAGCTTG
CCAGGCCTGCTGTCCTGGATGATTTTGTTAGTACGATTGATTTACCTAATTATGGATGCA
CAATTCCTGAAAAGACCAGTTGCAGTGTTTATGGCTGGGGCTACACTGGATTGATCAACT
ATGATGGCCTATTACGAGTGGCACATCTCTATATAATGGGAAATGAGAAATGCAGCCAGC
ATCATCGAGGGAAGGTGACTCTGAATGAGTCTGAAATATGTGCTGGGGCTGAAAAGATTG
GATCAGGACCATGTGAGGGGGATTATGGTGGCCCACTTGTTTGTGAGCAACATAAAATGA
GAATGGTTCTTGGTGTCATTGTTCCTGGTCGTGGATGTGCCATTCCAAATCGTCCTGGTA
TTTTTGTCCGAGTAGCATATTATGCAAAATGGATACACAAAATTATTTTAACATATAAGG
TACCACAGTCATAGCTGAAGTAAGTGTGTCTGAAGCACCCACC
Tag Tag Free
ACCN NM_001010932
ORF Size 2172 bp
Insert Size 2300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010932.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001010932.1, NP_001010932
RefSeq Size 2805
Locus ID 3082
Cytogenetics 7q21.11
Protein Families ES Cell Differentiation/IPS, Transmembrane, Protease, Adult stem cells, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Focal adhesion, Pathways in cancer, Renal cell carcinoma, Melanoma
Gene Summary This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (3) lacks an in-frame segment in the middle coding region, compared to variant 1. The resulting isoform 3 lacks an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.