PLA2G1B (NM_000928) Human Untagged Clone

CAT#: SC300153

PLA2G1B (untagged)-Human phospholipase A2, group IB (pancreas) (PLA2G1B)


  "NM_000928" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PLA2G1B Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PLA2G1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLA2G1B
Synonyms PLA2; PLA2A; PPLA2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000928 edited
ATGAAACTCCTTGTGCTAGCTGTGCTGCTCACAGTGGCCGCCGCCGACAGCGGCATCAGC
CCTCGGGCCGTGTGGCAGTTCCGCAAAATGATCAAGTGCGTGATCCCGGGGAGTGACCCC
TTCTTGGAATACAACAACTACGGCTGCTACTGTGGCTTGGGGGGCTCAGGCACCCCCGTG
GATGAACTGGACAAGTGCTGCCAGACACATGACAACTGCTATGACCAGGCCAAGAAGCTG
GACAGCTGTAAATTTCTGCTGGACAACCCGTACACCCACACCTATTCATACTCGTGCTCT
GGCTCGGCAATCACCTGTAGCAGCAAAAACAAAGAGTGTGAGGCCTTCATTTGCAACTGC
GACCGCAACGCTGCCATCTGCTTTTCAAAAGCTCCATATAACAAGGCACACAAGAACCTG
GACACCAAGAAGTATTGTCAGAGTTGA
>OriGene 5' read for NM_000928 unedited
NNNNGGTTTCGGGGTTCATCATTTGTNATACNACTCACTATAGGCGGCCGCGATTCATTC
TGGTACCGAGCTCGGNATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTCAC
CTGGTCATCTCAGTTCTTTTCTCACCTTGACTGCAAGATGAAACTCCTTGTGCTAGCTGT
GCTGCTCACAGTGGCCGCCGCCGACAGCGGCATCAGCCCTCGGGCCGTGTGGCAGTTCCG
CAAAATGATCAAGTGCGTGATCCCGGNGAGTGACCCCTTCTTGGAATACAACAACTACGG
CTGCTACTGTGGCTTGGGGGGCTCAGGCACCCNCGTGGATGAACTGGACAAGTGCTGCCA
GACACATNGACACTGCTATGACCAGGCCAAGAAGCTGGACAGCTGTAAATTTCTGCTGGA
CAACCCGTACACCCACACCTATTCATACTCGTGCTCTGGCTCGGCAATCACCTGTAGCAG
CAAAAACAAAGAGTGTGAGGCCTTCATTTGCAACTGCGACCGCAACGCTGCCATCTGCTT
TTCAAAAGCTCCATATAACAAGGCACACATGAACCCTGGACACCAGAAGTATTGTCAGAG
TTGATATCACCTCTCAAAAAGCATCACTCTATCTGCCTCATCTCACACTGTACTCTCCAA
TAAGCACCCTGTTTGAAAGACCTCATTGATGAAGGCCGAATTCTGCAGAATTCCTCACAC
TGGCGGGCGGTCGAGCATGCATTTAGATTGCGGCCCCGGTCATAGCTGTTTCCTGAACAG
ATCCCGGGTGGCATCCCTGTGACCCTTCCCCCATGGCTTTTCTGGCCCTGTGGGTTGGCC
ACTCCAGGGCCAACCACCCCTGTCCCAATAAAATTAATTTGCTCATTT
Restriction Sites Please inquire     
ACCN NM_000928
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000928.2, NP_000919.1
RefSeq Size 585 bp
RefSeq ORF 447 bp
Locus ID 5319
UniProt ID P04054
Cytogenetics 12q24.31
Protein Families Druggable Genome, Secreted Protein
Protein Pathways alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
Gene Summary This gene encodes a secreted member of the phospholipase A2 (PLA2) class of enzymes, which is produced by the pancreatic acinar cells. The encoded calcium-dependent enzyme catalyzes the hydrolysis of the sn-2 position of membrane glycerophospholipids to release arachidonic acid (AA) and lysophospholipids. AA is subsequently converted by downstream metabolic enzymes to several bioactive lipophilic compounds (eicosanoids), including prostaglandins (PGs) and leukotrienes (LTs). The enzyme may be involved in several physiological processes including cell contraction, cell proliferation and pathological response. [provided by RefSeq, Aug 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.