Luteinizing Hormone beta (LHB) (NM_000894) Human Untagged Clone

CAT#: SC300146

LHB (untagged)-Human luteinizing hormone beta polypeptide (LHB)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Luteinizing Hormone beta
• Synonyms: CGB4; HH23; LSH-B; LSH-beta
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000894 edited
  GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGAGATGCTCCAGGGGCTGCTGCT
  GTTGCTGCTGCTGAGCATGGGCGGGGCATGGGCATCCAGGGAGCCGCTTCGGCCATGGTG
  CCACCCCATCAATGCCATCCTGGCTGTCGAGAAGGAGGGCTGCCCAGTGTGCATCACCGT
  CAACACCACCATCTGTGCCGGCTACTGCCCCACCATGATGCGCGTGCTGCAGGCGGTCCT
  GCCGCCCCTGCCTCAGGTGGTGTGCACCTACCGTGATGTGCGCTTCGAGTCCATCCGGCT
  CCCTGGCTGCCCGCGTGGTGTGGACCCCGTGGTCTCCTTCCCTGTGGCTCTCAGCTGTCG
  CTGTGGACCCTGCCGCCGCAGCACCTCTGACTGTGGGGGTCCCAAAGACCACCCCTTGAC
  CTGTGACCACCCCCAACTCTCAGGCCTCCTCTTCCTCTAGGGCCTCATGGGCCCAGCTTT
  CTTGTAC
  
• Restriction Sites: Please inquire
• ACCN: NM_000894
• Insert Size: 500 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000894.2.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000894.2, NP_000885.1
• RefSeq Size: 523 bp
• RefSeq ORF: 426 bp
• Locus ID: 3972
• UniProt ID: P01229
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: GnRH signaling pathway, Neuroactive ligand-receptor interaction
• Gene Summary: This gene is a member of the glycoprotein hormone beta chain family and encodes the beta subunit of luteinizing hormone (LH). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. LH is expressed in the pituitary gland and promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids. The genes for the beta chains of chorionic gonadotropin and for luteinizing hormone are contiguous on chromosome 19q13.3. Mutations in this gene are associated with hypogonadism which is characterized by infertility and pseudohermaphroditism. [provided by RefSeq, Jul 2008]