HTR2B (NM_000867) Human Untagged Clone

CAT#: SC300142

HTR2B (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 2B (HTR2B)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HTR2B (NM_000867) Human Untagged Clone
Symbol HTR2B
Synonyms 5-HT(2B); 5-HT2B
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000867 edited
GGGGGTATTTGTTTCACTGCTTTCAACCGCCTGTGCTGGAGGCTCAGAATAAGTCAATGG
GAGGAGGATTTCAGTCACAGCAGCAAGCAAGTCTAGTGAACAGATAAGATGACATGCTCA
GCAAAATAACAACGAAACCAGAGGGGGAACTCTCTGGCATGCAAGTTCAAACACGACTCT
ACAACTACGGCAGAAAAAGAGAGAGAGAGAAACTAAAAATATATATATATCCTATTTTTT
TCACAGCTATCAGTTTCTTTCACTGAGCTTTCCTAAATTTAAGCCTCTAGAAAATAATAA
ATACTTGGATATCTTACCTACAAACATGGACAGATGTGTGTATGCGCTCATTTTAGAGAA
CTTGAATTTTTTTTTTTAAAGGAAGGTGTCAACTTTGGCTTTTGAGTGTTTGGCATGGTT
ACAATGCCTTAAAAAAACAGATGAGCAGCTTAGCTACTAACCATGCTGACCACTGTTCGG
AACGGGATTGAATCACAGAAAAACAGCAAATGGCTCTCTCTTACAGAGTGTCTGAACTTC
AAAGCACAATTCCTGAGCACATTTTGCAGAGCACCTTTGTTCACGTTATCTCTTCTAACT
GGTCTGGATTACAGACAGAATCAATACCAGAGGAAATGAAACAGATTGTTGAGGAACAGG
GAAATAAACTGCACTGGGCAGCTCTTCTGATACTCATGGTGATAATACCCACAATTGGTG
GAAATACCCTTGTTATTCTGGCTGTTTCACTGGAGAAGAAGCTGCAGTATGCTACTAATT
ACTTTCTAATGTCCTTGGCGGTGGCTGATTTGCTGGTTGGATTGTTTGTGATGCCAATTG
CCCTCTTGACAATAATGTTTGAGGCTATGTGGCCCCTCCCACTTGTTCTATGTCCTGCCT
GGTTATTTCTTGACGTTCTCTTTTCAACCGCATCCATCATGCATCTCTGTGCCATTTCAG
TGGATCGTTACATAGCCATCAAAAAGCCAATCCAGGCCAATCAATATAACTCACGGGCTA
CAGCATTCATCAAGATTACAGTGGTGTGGTTAATTTCAATAGGCATTGCCATTCCAGTCC
CTATTAAAGGGATAGAGACTGATGTGGACAACCCAAACAATATCACTTGTGTGCTGACAA
AGGAACGTTTTGGCGATTTCATGCTCTTTGGCTCACTGGCTGCCTTCTTCACACCTCTTG
CAATTATGATTGTCACCTACTTTCTCACTATCCATGCTTTACAGAAGAAGGCTTACTTAG
TCAAAAACAAGCCACCTCAACGCCTAACATGGTTGACTGTGTCTACAGTTTTCCAAAGGG
ATGAAACACCTTGCTCGTCACCGGAAAAGGTGGCAATGCTGGATGGTTCTCGAAAGGACA
AGGCTCTGCCCAACTCAGGTGATGAAACACTTATGCGAAGAACATCCACAATTGGGAAAA
AGTCAGTGCAGACCATTTCCAACGAACAGAGAGCCTCAAAGGTCCTAGGGATTGTGTTTT
TCCTCTTTTTGCTTATGTGGTGTCCCTTCTTTATTACAAATATAACTTTAGTTTTATGTG
ATTCCTGTAACCAAACTACTCTCCAAATGCTCCTGGAGATATTTGTGTGGATAGGCTATG
TTTCCTCAGGAGTGAATCCTTTGGTCTACACCCTCTTCAATAAGACATTTCGGGATGCAT
TTGGCCGATATATCACCTGCAATTACCGGGCCACAAAGTCAGTAAAAACTCTCAGAAAAC
GCTCCAGTAAGATCTACTTCCGGAATCCAATGGCAGAGAACTCTAAGTTTTTCAAGAAAC
ATGGAATTCGAAATGGGATTAACCCTGCCATGTACCAGAGTCCAATGAGGCTCCGAAGTT
CAACCATTCAGTCTTCATCAATCATTCTACTAGATACGCTTCTCCTCACTGAAAATGAAG
GTGACAAAACTGAAGAGCGAGTTAGTTATGTATAGCAGAACTGGCAGTTGTCATCAAACA
TAATGATGAGTAAGATGATGAATGAGATGTAAATGTGCCAAGAATATATTATATAAAGAA
TTTTATGTCATATATCAAATCATCTCTTTAACCTAAGATGTAAGTATTAAGAATATCTAA
TTTTCCTAATTTGGACAAGATTATTCCATGAGGAAAATAATTTTATATAGCTACAAATGA
AAACAATCCAGCACTCTGGTTAAATTTTAAGGTATTCGAATGAAATAAAGTCAAATCAAT
AAATTTCAGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Tag Tag Free
ACCN NM_000867
ORF Size 1446 bp
Insert Size 2300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone is found to be a perfect match to NM_000867.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000867.2, NP_000858
RefSeq Size 2260
RefSeq ORF 1446
Locus ID 3357
Cytogenetics 2q37.1
Protein Families Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Gap junction
Gene Summary This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.