CACNA1B (NM_000718) Human Untagged Clone

CAT#: SC300124

CACNA1B (untagged)-Human calcium channel, voltage-dependent, N type, alpha 1B subunit (CACNA1B)

USD 4,471


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CACNA1B (NM_000718) Human Untagged Clone
Symbol CACNA1B
Synonyms BIII; CACNL1A5; CACNN; Cav2.2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000718 edited
AGCCATGGTCCGCTTCGGGGACGAGCTGGGCGGCCGCTATGGAGGCCCCGGCGGCGGAGA
GCGGGCCCGGGGCGGCGGGGCCGGCGGGGCGGGGGGCCCGGGTCCCGGGGGGCTGCAGCC
CGGCCAGCGGGTCCTCTACAAGCAATCGATCGCGCAGCGCGCGCGGACCATGGCGCTGTA
CAACCCCATCCCGGTCAAGCAGAACTGCTTCACCGTCAACCGCTCGCTCTTCGTCTTCAG
CGAGGACAACGTCGTCCGCAAATACGCGAAGCGCATCACCGAGTGGCCTCCATTCGAGTA
TATGATCCTGGCCACCATCATCGCCAACTGCATCGTGCTGGCCCTGGAGCAGCACCTCCC
TGATGGGGACAAAACGCCCATGTCCGAGCGGCTGGACGACACGGAGCCCTATTTCATCGG
GATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTTTGTCTTCCACAAGGG
CTCTTACCTGCGGAACGGCTGGAACGTCATGGACTTCGTGGTCGTCCTCACAGGGATCCT
TGCCACGGCTGGAACTGACTTCGACCTGCGAACACTGAGGGCTGTGCGTGTGCTGAGGCC
CCTGAAGCTGGTGTCTGGGATTCCAAGTTTGCAGGTGGTGCTCAAGTCCATCATGAAGGC
CATGGTTCCACTCCTGCAGATTGGGCTGCTTCTCTTCTTTGCCATCCTCATGTTTGCCAT
CATTGGCCTGGAGTTCTACATGGGCAAGTTCCACAAGGCCTGTTTCCCCAACAGCACAGA
TGCGGAGCCCGTGGGTGACTTCCCCTGTGGCAAGGAGGCCCCAGCCCGGCTGTGCGAGGG
CGACACTGAGTGCCGGGAGTACTGGCCAGGACCCAACTTTGGCATCACCAACTTTGACAA
TATCCTGTTTGCCATCTTGACGGTGTTCCAGTGCATCACCATGGAGGGCTGGACTGACAT
CCTCTATAATACAAACGATGCGGCCGGCAACACCTGGAACTGGCTCTACTTCATCCCTCT
CATCATCATCGGCTCCTTCTTCATGCTCAACCTGGTGCTGGGCGTGCTCTCGGGGGAGTT
TGCCAAGGAGCGAGAGAGGGTGGAGAACCGCCGCGCCTTCCTGAAGCTGCGCCGGCAGCA
GCAGATCGAGCGAGAGCTCAACGGGTACCTGGAGTGGATCTTCAAGGCGGAGGAAGTCAT
GCTGGCCGAGGAGGACAGGAATGCAGAGGAGAAGTCCCCTTTGGACGTGCTGAAGAGAGC
GGCCACCAAGAAGAGCAGAAATGACCTGATCCACGCAGAGGAGGGAGAGGACCGGTTTGC
AGATCTCTGTGCTGTTGGATCCCCCTTCGCCCGCGCCAGCCTCAAGAGCGGGAAGACAGA
GAGCTCGTCATACTTCCGGAGGAAGGAGAAGATGTTCCGGTTTTTTATCCGGCGCATGGT
GAAGGCTCAGAGCTTCTACTGGGTGGTGCTGTGCGTGGTGGCCCTGAACACACTGTGTGT
GGCCATGGTGCATTACAACCAGCCGCGGCGGCTTACCACGACCCTGTATTTTGCAGAGTT
TGTTTTCCTGGGTCTCTTCCTCACAGAGATGTCCCTGAAGATGTATGGCCTGGGGCCCAG
AAGCTACTTCCGGTCCTCCTTCAACTGCTTCGACTTTGGGGTCATCGTGGGGAGCGTCTT
TGAAGTGGTCTGGGCGGCCATCAAGCCGGGAAGCTCCTTTGGGATCAGTGTGCTGCGGGC
CCTCCGCCTGCTGAGGATCTTCAAAGTCACGAAGTACTGGAGCTCCCTGCGGAACCTGGT
GGTGTCCCTGCTGAACTCCATGAAGTCCATCATCAGCCTGCTCTTCTTGCTCTTCCTGTT
CATTGTGGTCTTCGCCCTGCTGGGGATGCAGCTGTTTGGGGGACAGTTCAACTTCCAGGA
TGAGACTCCCACAACCAACTTCGACACCTTCCCTGCCGCCATCCTCACTGTCTTCCAGAT
CCTGACGGGAGAGGACTGGAATGCAGTGATGTATCACGGGATCGAATCGCAAGGCGGCGT
CAGCAAAGGCATGTTCTCGTCCTTTTACTTCATTGTCCTGACACTGTTCGGAAACTACAC
TCTGCTGAATGTCTTTCTGGCCATCGCTGTGGACAACCTGGCCAACGCCCAAGAGCTGAC
CAAGGATGAAGAGGAGATGGAAGAAGCAGCCAATCAGAAGCTTGCTCTGCAAAAGGCCAA
AGAAGTGGCTGAAGTCAGCCCCATGTCTGCCGCGAACATCTCCATCGCCGCCAGGCAGCA
GAACTCGGCCAAGGCGCGCTCGGTGTGGGAGCAGCGGGCCAGCCAGCTCCGGCTGCAGAA
CCTGCGGGCCAGCTGCGAGGCGCTGTACAGCGAGATGGACCCCGAGGAGCGGCTGCGCTT
CGCCACTACGCGCCACCTGCGGCCCGACATGAAGACGCATCTGGACCGGCCGCTGGTGGT
GGAGCTGGGCCGCGACGGCGCGCGGGGCCCCGTGGGAGGCAAAGCCCGACCTGAGGCTGC
GGAGGCCCCCGAGGGCGTCGACCCTCCGCGCAGGCACCACCGGCACCGCGACAAGGACAA
GACCCCCGCGGCGGGGGACCAGGACCGAGCAGAGGCCCCGAAGGCGGAGAGCGGGGAGCC
CGGTGCCCGGGAGGAGCGGCCGCGGCCGCACCGCAGCCACAGCAAGGAGGCCGCGGGGCC
CCCGGAGGCGCGGAGCGAGCGCGGCCGAGGCCCAGGCCCCGAGGGCGGCCGGCGGCACCA
CCGGCGCGGCTCCCCGGAGGAGGCGGCCGAGCGGGAGCCCCGACGCCACCGCGCGCACCG
GCACCAGGATCCGAGCAAGGAGTGCGCCGGCGCCAAGGGCGAGCGGCGCGCGCGGCACCG
CGGCGGCCCCCGAGCGGGGCCCCGGGAGGCGGAGAGCGGGGAGGAGCCGGCGCGGCGGCA
CCGGGCCCGGCACAAGGCGCAGCCTGCTCACGAGGCTGTGGAGAAGGAGACCACGGAGAA
GGAGGCCACGGAGAAGGAGGCTGAGATAGTGGAAGCCGACAAGGAAAAGGAGCTCCGGAA
CCACCAGCCCCGGGAGCCACACTGTGACCTGGAGACCAGTGGGACTGTGACTGTGGGTCC
CATGCACACACTGCCCAGCACCTGTCTCCAGAAGGTGGAGGAACAGCCAGAGGATGCAGA
CAATCAGCGGAACGTCACTCGCATGGGCAGTCAGCCCCCAGACCCGAACACTATTGTACA
TATCCCAGTGATGCTGACGGGCCCTCTTGGGGAAGCCACGGTCGTTCCCAGTGGTAACGT
GGACCTGGAAAGCCAAGCAGAGGGGAAGAAGGAGGTGGAAGCGGATGACGTGATGAGGAG
CGGCCCCCGGCCTATCGTCCCATACAGCTCCATGTTCTGTTTAAGCCCCACCAACCTGCT
CCGCCGCTTCTGCCACTACATCGTGACCATGAGGTACTTCGAGGTGGTCATTCTCGTGGT
CATCGCCTTGAGCAGCATCGCCCTGGCTGCTGAGGACCCAGTGCGCACAGACTCGCCCAG
GAACAACGCTCTGAAATACCTGGATTACATTTTCACTGGTGTCTTTACCTTTGAGATGGT
GATAAAGATGATCGACTTGGGACTGCTGCTTCACCCTGGAGCCTATTTCCGGGACTTGTG
GAACATTCTGGACTTCATTGTGGTCAGTGGCGCCCTGGTGGCGTTTGCTTTCTCAGGATC
CAAAGGGAAAGACATCAATACCATCAAGTCTCTGAGAGTCCTTCGTGTCCTGCGGCCCCT
CAAGACCATCAAACGGCTGCCCAAGCTCAAGGCTGTGTTTGACTGTGTGGTGAACTCCCT
GAAGAATGTCCTCAACATCTTGATTGTCTACATGCTCTTCATGTTCATATTTGCCGTCAT
TGCGGTGCAGCTCTTCAAAGGGAAGTTTTTCTACTGCACAGATGAATCCAAGGAGCTGGA
GAGGGACTGCAGGGGTCAGTATTTGGATTATGAGAAGGAGGAAGTGGAAGCTCAGCCCAG
GCAGTGGAAGAAATACGACTTTCACTACGACAATGTGCTCTGGGCTCTGCTGACGCTGTT
CACAGTGTCCACGGGAGAAGGCTGGCCCATGGTGCTGAAACACTCCGTGGATGCCACCTA
TGAGGAGCAGGGTCCAAGCCCTGGGTACCGCATGGAGCTGTCCATCTTCTACGTGGTCTA
CTTTGTGGTCTTTCCCTTCTTCTTCGTCAACATCTTTGTGGCTTTGATCATCATCACCTT
CCAGGAGCAGGGGGACAAGGTGATGTCTGAATGCAGCCTAGAGAAGAACGAGAGGGCTTG
CATTGACTTCGCCATCAGCGCCAAACCCCTGACACGGTACATGCCCCAAAACCGGCAGTC
GTTCCAGTATAAGACGTGGACATTTGTGGTCTCCCCGCCCTTTGAATACTTCATCATGGC
CATGATAGCCCTCAACACTGTGGTGCTGATGATGAAGTTCTATGATGCACCCTATGAGTA
CGAGCTGATGCTGAAATGCCTGAACATCGTGTTCACATCCATGTTCTCCATGGAATGCGT
GCTGAAGATCATCGCCTTTGGGGTGCTGAACTATTTCAGAGATGCCTGGAATGTCTTTGA
CTTTGTCACTGTGTTGGGAAGTATTACTGATATTTTAGTAACAGAGATTGCG::::::AA
CAATTTCATCAACCTCAGCTTCCTCCGCCTCTTTCGAGCTGCGCGGCTGATCAAGCTGCT
CCGCCAGGGCTACACCATCCGCATCCTGCTGTGGACCTTTGTCCAGTCCTTCAAGGCCCT
GCCCTACGTGTGTCTGCTCATTGCCATGCTGTTCTTCATCTACGCCATCATCGGCATGCA
GGTGTTTGGGAATATTGCCCTGGATGATGACACCAGCATCAACCGCCACAACAACTTCCG
GACGTTTTTGCAAGCCCTGATGCTGCTGTTCAGGAGCGCCACGGGGGAGGCCTGGCACGA
GATCATGCTGTCCTGCCTGAGCAACCAGGCCTGTGATGAGCAGGCCAATGCCACCGAGTG
TGGAAGTGACTTTGCCTACTTCTACTTCGTCTCCTTCATCTTCCTGTGCTCCTTTCTGAT
GTTGAACCTCTTTGTGGCTGTGATCATGGACAATTTTGAGTACCTCACGCGGGACTCTTC
CATCCTAGGTCCTCACCACTTGGATGAGTTCATCCGGGTCTGGGCTGAATACGACCCGGC
TGCGTGTGGGCGCATCAGTTACAATGACATGTTTGAGATGCTGAAACACATGTCCCCGCC
TCTGGGGCTGGGGAAGAAATGCCCTGCTCGAGTTGCTTACAAGCGCCTGGTTCGCATGAA
CATGCCCATCTCCAACGAGGACATGACTGTTCACTTCACGTCCACGCTGATGGCCCTCAT
CCGGACGGCACTGGAGATCAAGCTGGCCCCAGCTGGGACAAAGCAGCATCAGTGTGACGC
GGAGTTGAGGAAGGAGATTTCCGTTGTGTGGGCCAATCTGCCCCAGAAGACTTTGGACTT
GCTGGTACCACCCCATAAGCCTGATGAGATGACAGTGGGGAAGGTTTATGCAGCTCTGAT
GATATTCGACTTCTACAAGCAGAACAAAACCACCAGAGACCAGATGCAGCAGGCTCCTGG
AGGCCTCTCCCAGATGGGTCCTGTGTCCCTGTTCCACCCTCTGAAGGCCACCCTGGAGCA
GACACAGCCGGCTGTGCTCCGAGGAGCCCGGGTTTTCCTTCGACAGAAGAGTTCCACCTC
CCTCAGCAATGGCGGGGCCATACAAAACCAAGAGAGTGGCATCAAAGAGTCTGTCTCCTG
GGGCACTCAAAGGACCCAGGATGCACCCCATGAGGCCAGGCCACCCCTGGAGCGTGGCCA
CTCCACAGAGATCCCTGTGGGGCGGTCAGGAGCACTGGCTGTGGACGTTCAGATGCAGAG
CATAACCCGGAGGGGCCCTGATGGGGAGCCCCAGCCTGGGCTGGAGAGCCAGGGTCGAGC
GGCCTCCATGCCCCGCCTTGCGGCCGAGACTCAGCCCGTCACAGATGCCAGCCCCATGAA
GCGCTCCATCTCCACGCTGGCCCAGCGGCCCCGTGGGACTCATCTTTGCAGCACCACCCC
GGACCGCCCACCCCCTAGCCAGGCGTCGTCGCACCACCACCACCACCGCTGCCACCGCCG
CAGGGACAGGAAGCAGAGGTCCCTGGAGAAGGGGCCCAGCCTGTCTGCCGATATGGATGG
CGCACCAAGCAGTGCTGTGGGGCCGGGGCTGCCCCCGGGAGAGGGGCCTACAGGCTGCCG
GCGGGAACGAGAGCGCCGGCAGGAGCGGGGCCGGTCCCAGGAGCGGAGGCAGCCCTCATC
CTCCTCCTCGGAGAAGCAGCGCTTCTACTCCTGCGACCGCTTTGGGGGCCGTGAGCCCCC
GAAGCCCAAGCCCTCCCTCAGCAGCCACCCAACGTCGCCAACAGCTGGCCAGGAGCCGGG
ACCCCACCCACAGGGCAGTGGTTCCGTGAATGGGAGCCCCTTGCTGTCAACATCTGGTGC
TAGCACCCCCGGCCGCGGTGGGCGGAGGCAGCTCCCCCAGACGCCCCTGACTCCCCGCCC
CAGCATCACCTACAAGACGGCCAACTCCTCACCCATCCACTTCGCCGGGGCTCAGACCAG
CCTCCCTGCCTTCTCCCCAGGCCGGCTCAGCCGTGGGCTTTCCGAACACAACGCCCTGCT
GCAGAGAGACCCCCTCAGCCAGCCCCTGGCCCCTGGCTCTCGAATTGGCTCTGACCCTTA
CCTGGGGCAGCGTCTGGACAGTGAGGCCTCTGTCCACGCCCTGCCTGAGGACACGCTCAC
TTTCGAGGAGGCTGTGGCCACCAACTCGGGCCGCTCCTCCAGGACTTCCTACGTGTCCTC
CCTGACCTCCCAGTCTCACCCTCTCCGCCGCGTGCCCAACGGTTACCACTGCACCCTGGG
ACTCAGCTCGGGTGGCCGAGCACGGCACAGCTACCACCACCCTGACCAAGACCACTGGTG
CTAGCTGCACCGTGACCGCTCAGACGCCTGCATGCAGCAGGCGTGTGTTCCAGTGGATGA
GTTTTATCATCCACACGGGGCAGTCGGCCCTCGGGGGAGGCCTTGCCCACCTTGGTGAGG
CTCCTGTGGCCCCTCCCTCCCCCTCCTCCCCTTTTTTACTCTAGACGACGAATAAAGCCC
TGTTAGAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000718 unedited
GGCAGACATTTTTTTACGACTCACTATTAGGGACGGCCGCGAATTCGAGCCATGGTCCGC
TTCGGGGACGAGCTGGGCGGCCGCTATGGAGGCCCCGGCGGCGGAGAGCGGGCCCGGGGC
GGCGGGGCCGGCGGGGCGGGGGGCCCGGGTCCCGGGGGGCTGCAGCCCGGCCAGCGGGTC
CTCTACAAGCAATCGATCGCGCAGCGCGCGCGGACCATGGCGCTGTACAACCCCATCCCG
GTCAAGCAGAACTGCTTCACCGTCAACCGCTCGCTCTTCGTCTTCAGCGAGGACAACGTC
GTCCGCAAATACGCGAAGCGCATCACCGAGTGGCCTCCATTCGAGTATATGATCCTGGCC
ACCATCATCGCCAACTGCATCGTGCTGGCCCTGGAGCAGCACCTCCCTGATGGGGACAAA
ACGCCCATGTCCGAGCGGCTGGACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTC
GAGGCAGGGATCAAAATCATCGCTCTGGGCTTTGTCTTCCACAAGGGCTCTTACCTGCGG
AACGGCTGGAACGTCATGGACTTCGTGGTCGTCCTCACAGGGATCCTTGCCACGGCTGGA
ACTGACTTCGACCTGCGAACACTGAAGGCTGTGCGTGTGCTGAGGCCCCTGAACTTGTGG
CTGGGTTCCAAGTTGCAGTGGTGCTCAATCCATCATGAGGCCATGTTCCCCTCCCTGCAA
TGGGCTGTTTTTTTCTTTGCCTCCTTATGTTTGCCCATCTTGGCCTGGATTTTACAGGGG
CAGTTCCACAAGCCTGGTTCCCCACAGCCAAGATGCCGAACCCGTGGTGACATTCCCCGG
GGCAAGGAAGCCCCCAACCCGGCTGGGCAAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000718 unedited
GNGNGAGCACTGGGGNAGGGTCACAGGGATGCCACCCGGGTTCTGTTCAGGNAACAGCTA
TGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCCTAACAGGGCTTTTTTCTTCGTCTAAA
GTAAAAAAGGGAAGGAGGGGGAGGGAGGGCCCACAGGACCCTCACCAAGGTGGGCAAGGC
CTCCCCCGAGGGCCGACTGCCCCGTGTGGATGATAAAACTCATCCACTGGAACACACCCC
TGCTGCTTGCAGGCTTTCTGAGCGGTCACGGTGCATCTAGCACCAATGTTCTTGGTCAGG
GTGGTGGTACCTGTCCCGTGCTCGCCCCCCGAGCTGGGTCCCAGGGTGCATTGTAACCCT
TGGGCCCCCGCCGGAAAGGTTAAACTGGAAGGTCAGGGAGCCACCTATGAATTCCTGGAG
ACCCGCCCAGTTTTGGCCCCACCTCTTCAAAGTTGCCTTTTCCCAGGCAGGCTTGCCCAG
GCCCTACTTTCCAACCCCTCCCCCGTTAAGGTTAAACCCTTTTCAAACCCCGGCCCCAGC
CCTTGTTTAGGGGTTCTTTTTTCCCAAAGGGCTTTTTTTTTGAAAACCCCCCGTTTACCC
CCCCCTTGGAAAAAAACCAGGAGGCTTTTTTTTTCCCCCCCGCAAAATTTTTTGGTTAAA
GATTTTCCCCCTTTTTAAGTATTCCTGGGGCCGGGATTTACGGCCCCTTTTGGGGACTCT
CCCCCCCCCCCCCGGCCCGGGGGTT
Tag Tag Free
ACCN NM_000718
ORF Size 7020 bp
Insert Size 7300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000718.1, NP_000709
RefSeq Size 7364
RefSeq ORF 7020
Locus ID 774
Cytogenetics 9q34.3
Protein Families Ion Channels: Calcium, Transmembrane, Druggable Genome
Protein Pathways MAPK signaling pathway, Calcium signaling pathway, Taste transduction, Type II diabetes mellitus
Gene Summary Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death. The isoform alpha-1B gives rise to N-type calcium currents. N-type calcium channels belong to the 'high-voltage activated' (HVA) group and are blocked by omega-conotoxin-GVIA (omega-CTx-GVIA) and by omega-agatoxin-IIIA (omega-Aga-IIIA). They are however insensitive to dihydropyridines (DHP), and omega-agatoxin-IVA (omega-Aga-IVA). Calcium channels containing alpha-1B subunit may play a role in directed migration of immature neurons. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.