CFTR (NM_000492) Human Untagged Clone

CAT#: SC300080

CFTR (untagged)-Human cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR)

USD 2,833


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CFTR (NM_000492) Human Untagged Clone
Symbol CFTR
Synonyms ABC35; ABCC7; CF; CFTR/MRP; dJ760C5.1; MRP7; TNR-CFTR
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000492 edited
GGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGA
GACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTG
GACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCA
AATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAG
AGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTG
GAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCC
TCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTAT
CGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACA
CCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTT
GATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACA
ACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACA
TTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTT
ACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGG
GCTAGGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACT
TGTGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGA
AGCAATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGC
AGCCTATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTT
TTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCAC
CATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACA
AACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGA
ATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGC
CTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAG
AAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCC
TGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATC
CACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGA
GGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCC
TGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAG
CGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATAT
AGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGC
AAGAGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGA
TGTTTTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAAC
TAGGATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTT
GCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGA
CTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAA
TTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTG
GACAGAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAA
TTCTATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTT
ACAAATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGT
ACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCC
CACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCA
TACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGC
ACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGA
TATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATT
AATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAAC
AGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA
ACTCAAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTT
AAAAGGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCA
CAAAGCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTT
CCAAATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCAT
TTTAACAACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATAT
CATGAGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATC
TGTGAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAAC
CAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAA
GAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATA
CACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAG
GGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAG
ACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTT
GCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAAC
ATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGC
AGATGAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCT
TGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATC
TGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGT
AACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCT
CTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAA
CAAAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCA
AGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAA
GTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAG
GCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAATTGGAGCTCGTG
GGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAG
GATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000492 unedited
NTTTGTCGGAGTTTATATTTTGTATACGACTCACTATAGGCGGCCGCGATTCGCCCTTGG
TCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGA
CCATGCAGAGGTCGCCTCTGGAAAAGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGAC
CAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAAT
CCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGA
GCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAG
ATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCANAGCAGTACAGCCTCT
CTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACCAAGGAGAACGCTCTATCGC
GATTTATCTAAGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGGCTCTACCCCC
AGCCATTTTTGGCCTTATTACATGGAATGCAGATGAAATAGCTATGTTTAGTTTGGATTA
TTAAGAGACCTTAAAGCTGTCAAACCCGGGTTCTAGATAAAAAAGTTTTTGAACAAACTT
GTTATTCTCCTTTCCAACAACCTGAACAAATTTTATGAAAGATTTGCTTTGCCCCATTTT
GGGGGGATCGCTCCCTTGGCAAGGGCACCTCCTCAGGGGGCCTATCTTGGGGATTTGTTA
CAGGCGTTTGTGCCTTTTGGGGACTTGGGATTCCCGGAAAGACCCCTGGCCCTTTTTTAA
GCTGGGGCTTTTGGGAGAAATGTTGTTTGAAGTTCCCCAAATTTCAGAGGCGCTTGGGAA
AATCCCCTGCGAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000492 unedited
NCGTAAAANNNNNNGGGCCCCCATGGGAGATGGTCAGCTTGCCAGGGCCAGGNAAAGCAC
TGGGGNAAGGGGTCACAGGGNATGCCACCCGGGNATCTGTTCAGAAAAGCTATGACCGCG
GCCGCAATCTAGAGTCGACAAGCTTGATATCGGTACCGAGCTCGGATCCACTAGTAACGG
CCGCCAGTGTGCTGGAATTCGCCCTTGTCCTCAATTCCCCTTACCAAATGTTTCTTTTTT
AAAAAAAAACTTAATTCATCCTTGTTTTCTGAGGCAGAGGTAACTGTTCCACGAGCTCCA
ATTCCATGAGGTGACTGTCCCACGAGCTCCAATTCCATGAGCAAATGTCCCATGTCAACA
TTTATGCTGCTCTCTAAAGCCTTGTATCTTGCACCTCTTCTTCTGTCTCCTCTTTCAGAG
CAGCAATCTGGGGCTTAGACTTGCACTTGCTTGAGTTCCGGTGGGGAAAGAGCTTCACCC
TGTCGGAGGGGCTGATGGCTTGCCGGAAGAGGCTCCTCTCGTTCAGCAGTTTCTGGATGG
AATCGTACTGCCGCACTTTGTTCTCTTCTATGACCAAAAATTGTTGGCATTCCAGCATTG
CTTCTATCCTGTGTTCACAGAGAATTACTGTGCAATCAGCAAATGCTTGTTTTAGAGTTC
TTCTAATTATTTGGTATGTTACTGGATCCAAATGAGCACTGNGTTCATCAAGCAGCAAGA
TCTTCGCCTTACTGAGAACAGATCTAGCCAAGCACATCAACTGCTTGTGGCCATGGCTTA
GGACACAGCCCCCATCCACAAGGACAAAGTCAAGCTCCCCAGGAAACTGTTCTATCACAG
ATCTGAGCCCAACCTCATCTGCAACTTTTCATAT
Tag Tag Free
ACCN NM_000492
ORF Size 4443 bp
Insert Size 4900
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000492.3, NP_000483
RefSeq Size 6132
RefSeq ORF 4443
Locus ID 1080
Cytogenetics 7q31.2
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters, Vibrio cholerae infection
Gene Summary This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily that is involved in multi-drug resistance. The encoded protein functions as a chloride channel and controls the regulation of other transport pathways. Mutations in this gene are associated with the autosomal recessive disorders cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternatively spliced transcript variants have been described, many of which result from mutations in this gene. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.