CIITA (NM_000246) Human Untagged Clone

CAT#: SC300035

CIITA (untagged)-Human class II, major histocompatibility complex, transactivator (CIITA)

USD 2,163


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CIITA (NM_000246) Human Untagged Clone
Symbol CIITA
Synonyms C2TA; CIITAIV; MHC2TA; NLRA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000246 edited
ATGCGTTGCCTGGCTCCACGCCCTGCTGGGTCCTACCTGTCAGAGCCCCAAGGCAGCTCA
CAGTGTGCCACCATGGAGTTGGGGCCCCTAGAAGGTGGCTACCTGGAGCTTCTTAACAGC
GATGCTGACCCCCTGTGCCTCTACCACTTCTATGACCAGATGGACCTGGCTGGAGAAGAA
GAGATTGAGCTCTACTCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCAGG
CTGTTGTGTGACATGGAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGCGGAA
CTGGACCAGTATGTCTTCCAGGACTCCCAGCTGGAGGGCCTGAGCAAGGACATTTTCAAG
CACATAGGACCAGATGAAGTGATCGGTGAGAGTATGGAGATGCCAGCAGAAGTTGGGCAG
AAAAGTCAGAAAAGACCCTTCCCAGAGGAGCTTCCGGCAGACCTGAAGCACTGGAAGCCA
GCTGAGCCCCCCACTGTGGTGACTGGCAGTCTCCTAGTGGGACCAGTGAGCGACTGCTCC
ACCCTGCCCTGCCTGCCACTGCCTGCGCTGTTCAACCAGGAGCCAGCCTCCGGCCAGATG
CGCCTGGAGAAAACCGACCAGATTCCCATGCCTTTCTCCAGTTCCTCGTTGAGCTGCCTG
AATCTCCCTGAGGGACCCATCCAGTTTGTCCCCACCATCTCCACTCTGCCCCATGGGCTC
TGGCAAATCTCTGAGGCTGGAACAGGGGTCTCCAGTATATTCATCTACCATGGTGAGGTG
CCCCAGGCCAGCCAAGTACCCCCTCCCAGTGGATTCACTGTCCACGGCCTCCCAACATCT
CCAGACCGGCCAGGCTCCACCAGCCCCTTCGCTCCATCAGCCACTGACCTGCCCAGCATG
CCTGAACCTGCCCTGACCTCCCGAGCAAACATGACAGAGCACAAGACGTCCCCCACCCAA
TGCCCGGCAGCTGGAGAGGTCTCCAACAAGCTTCCAAAATGGCCTGAGCCGGTGGAGCAG
TTCTACCGCTCACTGCAGGACACGTATGGTGCCGAGCCCGCAGGCCCGGATGGCATCCTA
GTGGAGGTGGATCTGGTGCAGGCCAGGCTGGAGAGGAGCAGCAGCAAGAGCCTGGAGCGG
GAACTGGCCACCCCGGACTGGGCAGAACGGCAGCTGGCCCAAGGAGGCCTGGCTGAGGTG
CTGTTGGCTGCCAAGGAGCACCGGCGGCCGCGTGAGACACGAGTGATTGCTGTGCTGGGC
AAAGCTGGTCAGGGCAAGAGCTATTGGGCTGGGGCAGTGAGCCGGGCCTGGGCTTGTGGC
CGGCTTCCCCAGTACGACTTTGTCTTCTCTGTCCCCTGCCATTGCTTGAACCGTCCGGGG
GATGCCTATGGCCTGCAGGATCTGCTCTTCTCCCTGGGCCCACAGCCACTCGTGGCGGCC
GATGAGGTTTTCAGCCACATCTTGAAGAGACCTGACCGCGTTCTGCTCATCCTAGACGCC
TTCGAGGAGCTGGAAGCGCAAGATGGCTTCCTGCACAGCACGTGCGGACCGGCACCGGCG
GAGCCCTGCTCCCTCCGGGGGCTGCTGGCCGGCCTTTTCCAGAAGAAGCTGCTCCGAGGT
TGCACCCTCCTCCTCACAGCCCGGCCCCGGGGCCGCCTGGTCCAGAGCCTGAGCAAGGCC
GACGCCCTATTTGAGCTGTCCGGCTTCTCCATGGAGCAGGCCCAGGCATACGTGATGCGC
TACTTTGAGAGCTCAGGGATGACAGAGCACCAAGACAGAGCCCTGACGCTCCTCCGGGAC
CGGCCACTTCTTCTCAGTCACAGCCACAGCCCTACTTTGTGCCGGGCAGTGTGCCAGCTC
TCAGAGGCCCTGCTGGAGCTTGGGGAGGACGCCAAGCTGCCCTCCACGCTCACGGGACTC
TATGTCGGCCTGCTGGGCCGTGCAGCCCTCGACAGCCCCCCCGGGGCCCTGGCAGAGCTG
GCCAAGCTGGCCTGGGAGCTGGGCCGCAGACATCAAAGTACCCTACAGGAGGACCAGTTC
CCATCCGCAGACGTGAGGACCTGGGCGATGGCCAAAGGCTTAGTCCAACACCCACCGCGG
GCCGCAGAGTCCGAGCTGGCCTTCCCCAGCTTCCTCCTGCAATGCTTCCTGGGGGCCCTG
TGGCTGGCTCTGAGTGGCGAAATCAAGGACAAGGAGCTCCCGCAGTACCTAGCATTGACC
CCAAGGAAGAAGAGGCCCTATGACAACTGGCTGGAGGGCGTGCCACGCTTTCTGGCTGGG
CTGATCTTCCAGCCTCCCGCCCGCTGCCTGGGAGCCCTACTCGGGCCATCGGCGGCTGCC
TCGGTGGACAGGAAGCAGAAGGTGCTTGCGAGGTACCTGAAGCGGCTGCAGCCGGGGACA
CTGCGGGCGCGGCAGCTGCTTGAGCTGCTGCACTGCGCCCACGAGGCCGAGGAGGCTGGA
ATTTGGCAGCACGTGGTACAGGAGCTCCCCGGCCGCCTCTCTTTCCTGGGCACCCGCCTC
ACGCCTCCTGATGCACATGTACTGGGCAAGGCCTTGGAGGCGGCGGGCCAAGACTTCTCC
CTGGACCTCCGCAGCACTGGCATTTGCCCCTCTGGATTGGGGAGCCTCGTGGGACTCAGC
TGTGTCACCCGTTTCAGGGCTGCCTTGAGCGACACGGTGGCGCTGTGGGAGTCCCTGCAG
CAGCATGGGGAGACCAAGCTACTTCAGGCAGCAGAGGAGAAGTTCACCATCGAGCCTTTC
AAAGCCAAGTCCCTGAAGGATGTGGAAGACCTGGGAAAGCTTGTGCAGACTCAGAGGACG
AGAAGTTCCTCGGAAGACACAGCTGGGGAGCTCCCTGCTGTTCGGGACCTAAAGAAACTG
GAGTTTGCGCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTC
ACGGCCTTTTCCTCCCTGCAGCATCTGGACCTGGATGCGCTGAGTGAGAACAAGATCGGG
GACGAGGGTGTCTCGCAGCTCTCAGCCACCTTCCCCCAGCTGAAGTCCTTGGAAACCCTC
AATCTGTCCCAGAACAACATCACTGACCTGGGTGCCTACAAACTCGCCGAGGCCCTGCCT
TCGCTCGCTGCATCCCTGCTCAGGCTAAGCTTGTACAATAACTGCATCTGCGACGTGGGA
GCCGAGAGCTTGGCTCGTGTGCTTCCGGACATGGTGTCCCTCCGGGTGATGGACGTCCAG
TACAACAAGTTCACGGCTGCCGGGGCCCAGCAGCTCGCTGCCAGCCTTCGGAGGTGTCCT
CATGTGGAGACGCTGGCGATGTGGACGCCCACCATCCCATTCAGTGTCCAGGAACACCTG
CAACAACAGGATTCACGGATCAGCCTGAGATGA
Tag Tag Free
ACCN NM_000246
ORF Size 3393 bp
Insert Size 3800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000246.2, NP_000237
RefSeq Size 4661
RefSeq ORF 3393
Locus ID 4261
Cytogenetics 16p13.13
Protein Pathways Antigen processing and presentation, Primary immunodeficiency
Gene Summary This gene encodes a protein with an acidic transcriptional activation domain, 4 LRRs (leucine-rich repeats) and a GTP binding domain. The protein is located in the nucleus and acts as a positive regulator of class II major histocompatibility complex gene transcription, and is referred to as the 'master control factor' for the expression of these genes. The protein also binds GTP and uses GTP binding to facilitate its own transport into the nucleus. Once in the nucleus it does not bind DNA but rather uses an intrinsic acetyltransferase (AT) activity to act in a coactivator-like fashion. Mutations in this gene have been associated with bare lymphocyte syndrome type II (also known as hereditary MHC class II deficiency or HLA class II-deficient combined immunodeficiency), increased susceptibility to rheumatoid arthritis, multiple sclerosis, and possibly myocardial infarction. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013].
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) is 1 aa shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.