Insulin(INS) (BC005255) Human Untagged Clone

CAT#: SC128255

INS (untagged)-Human insulin (cDNA clone MGC:12292 IMAGE:3950204), complete cds

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Insulin(INS) (BC005255) Human Untagged Clone
Symbol INS
Synonyms ILPR; IRDN; OTTHUMP00000011161; OTTHUMP00000011162; OTTHUMP00000196038; proinsulin; Insulin
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for BC005255 edited
AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGATCACTGTCCTTCTGCCA
TGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACC
CAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACC
TAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACC
TGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGG
CCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCT
CCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCCCACCCG
CCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAACAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for BC005255 unedited
GGGGGTTTTGGGNGGGTTCAGCATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGC
CATTACGGCCGGGGAGCCCTCCAGGACAGCTGCATCAGAAGAGGCCATCAAGCAGATCAC
TGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTC
TGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTG
GAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGG
GAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGC
CTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGT
ACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGC
AGCCCCCCACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCNNCNN
ANAANAAAAAAAAAAAAAAAAAAAAAACCATGTCGGCCGCCTCGGCCCTCGAGAAGCTTT
CTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGA
CCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGT
CCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGG
GTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGAAAGACACCTGTNAGGCCTGCGGG
GTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTG
Tag Tag Free
ACCN BC005255
Insert Size 500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC005255.1, AAH05255
RefSeq Size 495
Locus ID 3630
Cytogenetics 11p15.5
Protein Families Secreted Protein, ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Oocyte meiosis, Regulation of autophagy, mTOR signaling pathway, Regulation of actin cytoskeleton, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Type II diabetes mellitus, Type I diabetes mellitus, Maturity onset diabetes of the young, Prostate cancer
Gene Summary After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations