KCNH2 (NM_000238) Human Untagged Clone

CAT#: SC128170

KCNH2 (untagged)-Human potassium voltage-gated channel, subfamily H (eag-related), member 2 (KCNH2), transcript variant 1

USD 2,215


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name KCNH2 (NM_000238) Human Untagged Clone
Symbol KCNH2
Synonyms ERG-1; ERG1; H-ERG; HERG; HERG1; Kv11.1; LQT2; SQT1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000238 edited
GCCCGCCCGGCCCGCCCATGGGCTCAGGATGCCGGTGCGGAGGGGCCACGTCGCGCCGCA
GAACACCTTCCTGGACACCATCATCCGCAAGTTTGAGGGCCAGAGCCGTAAGTTCATCAT
CGCCAACGCTCGGGTGGAGAACTGCGCCGTCATCTACTGCAACGACGGCTTCTGCGAGCT
GTGCGGCTACTCGCGGGCCGAGGTGATGCAGCGACCCTGCACCTGCGACTTCCTGCACGG
GCCGCGCACGCAGCGCCGCGCTGCCGCGCAGATCGCGCAGGCACTGCTGGGCGCCGAGGA
GCGCAAAGTGGAAATCGCCTTCTACCGGAAAGATGGGAGCTGCTTCCTATGTCTGGTGGA
TGTGGTGCCCGTGAAGAACGAGGATGGGGCTGTCATCATGTTCATCCTCAATTTCGAGGT
GGTGATGGAGAAGGACATGGTGGGGTCCCCGGCTCATGACACCAACCACCGGGGCCCCCC
CACCAGCTGGCTGGCCCCAGGCCGCGCCAAGACCTTCCGCCTGAAGCTGCCCGCGCTGCT
GGCGCTGACGGCCCGGGAGTCGTCGGTGCGGTCGGGCGGCGCGGGCGGCGCGGGCGCCCC
GGGGGCCGTGGTGGTGGACGTGGACCTGACGCCCGCGGCACCCAGCAGCGAGTCGCTGGC
CCTGGACGAAGTGACAGCCATGGACAACCACGTGGCAGGGCTCGGGCCCGCGGAGGAGCG
GCGTGCGCTGGTGGGTCCCGGCTCTCCGCCCCGCAGCGCGCCCGGCCAGCTCCCATCGCC
CCGGGCGCACAGCCTCAACCCCGACGCCTCGGGCTCCAGCTGCAGCCTGGCCCGGACGCG
CTCCCGAGAAAGCTGCGCCAGCGTGCGCCGCGCCTCGTCGGCCGACGACATCGAGGCCAT
GCGCGCCGGGGTGCTGCCCCCGCCACCGCGCCACGCCAGCACCGGGGCCATGCACCCACT
GCGCAGCGGCTTGCTCAACTCCACCTCGGACTCCGACCTCGTGCGCTACCGCACCATTAG
CAAGATTCCCCAAATCACCCTCAACTTTGTGGACCTCAAGGGCGACCCCTTCTTGGCTTC
GCCCACCAGTGACCGTGAGATCATAGCACCTAAGATAAAGGAGCGAACCCACAATGTCAC
TGAGAAGGTCACCCAGGTCCTGTCCCTGGGCGCCGACGTGCTGCCTGAGTACAAGCTGCA
GGCACCGCGCATCCACCGCTGGACCATCCTGCATTACAGCCCCTTCAAGGCCGTGTGGGA
CTGGCTCATCCTGCTGCTGGTCATCTACACGGCTGTCTTCACACCCTACTCGGCTGCCTT
CCTGCTGAAGGAGACGGAAGAAGGCCCGCCTGCTACCGAGTGTGGCTACGCCTGCCAGCC
GCTGGCTGTGGTGGACCTCATCGTGGACATCATGTTCATTGTGGACATCCTCATCAACTT
CCGCACCACCTACGTCAATGCCAACGAGGAGGTGGTCAGCCACCCCGGCCGCATTGCCGT
CCACTACTTCAAGGGCTGGTTCCTCATCGACATGGTGGCCGCCATCCCCTTCGACCTGCT
CATCTTTGGCTCTGGCTCTGAGGAGCTGATCGGGCTGCTGAAGACTGCGCGGCTGCTGCG
GCTGGTGCGCGTGGCGCGGAAGCTGGATCGCTACTCAGAGTACGGCGCGGCCGTGCTGTT
CTTGCTCATGTGCACCTTTGCGCTCATCGCGCACTGGCTGGCCTGCATCTGGTACGCCAT
CGGCAACATGGAGCAGCCACACATGGACTCACGCATCGGCTGGCTGCACAACCTGGGCGA
CCAGATAGGCAAACCCTACAACAGCAGCGGCCTGGGCGGCCCCTCCATCAAGGACAAGTA
TGTGACGGCGCTCTACTTCACCTTCAGCAGCCTCACCAGTGTGGGCTTCGGCAACGTCTC
TCCCAACACCAACTCAGAGAAGATCTTCTCCATCTGCGTCATGCTCATTGGCTCCCTCAT
GTACGCTAGCATCTTCGGCAACGTGTCGGCCATCATCCAGCGGCTGTACTCGGGCACAGC
CCGCTACCACACACAGATGCTGCGGGTGCGGGAGTTCATCCGCTTCCACCAGATCCCCAA
TCCCCTGCGCCAGCGCCTCGAGGAGTACTTCCAGCACGCCTGGTCCTACACCAACGGCAT
CGACATGAACGCGGTGCTGAAGGGCTTCCCTGAGTGCCTGCAGGCTGACATCTGCCTGCA
CCTGAACCGCTCACTGCTGCAGCACTGCAAACCCTTCCGAGGGGCCACCAAGGGCTGCCT
TCGGGCCCTGGCCATGAAGTTCAAGACCACACATGCACCGCCAGGGGACACACTGGTGCA
TGCTGGGGACCTGCTCACCGCCCTGTACTTCATCTCCCGGGGCTCCATCGAGATCCTGCG
GGGCGACGTCGTCGTGGCCATCCTGGGGAAGAATGACATCTTTGGGGAGCCTCTGAACCT
GTATGCAAGGCCTGGCAAGTCGAACGGGGATGTGCGGGCCCTCACCTACTGTGACCTACA
CAAGATCCATCGGGACGACCTGCTGGAGGTGCTGGACATGTACCCTGAGTTCTCCGACCA
CTTCTGGTCCAGCCTGGAGATCACCTTCAACCTGCGAGATACCAACATGATCCCGGGCTC
CCCCGGCAGTACGGAGTTAGAGGGTGGCTTCAGTCGGCAACGCAAGCGCAAGTTGTCCTT
CCGCAGGCGCACGGACAAGGACACGGAGCAGCCAGGGGAGGTGTCGGCCTTGGGGCCGGG
CCGGGCGGGGGCAGGGCCGAGTAGCCGGGGCCGGCCGGGGGGGCCGTGGGGGGAGAGCCC
GTCCAGTGGCCCCTCCAGCCCTGAGAGCAGTGAGGATGAGGGCCCAGGCCGCAGCTCCAG
CCCCCTCCGCCTGGTGCCCTTCTCCAGCCCCAGGCCCCCCGGAGAGCCGCCGGGTGGGGA
GCCCCTGATGGAGGACTGCGAGAAGAGCAGCGACACTTGCAACCCCCTGTCAGGCGCCTT
CTCAGGAGTGTCCAACATTTTCAGCTTCTGGGGGGACAGTCGGGGCCGCCAGTACCAGGA
GCTCCCTCGATGCCCCGCCCCCACCCCCAGCCTCCTCAACATCCCCCTCTCCAGCCCGGG
TCGGCGGCCCCGGGGCGACGTGGAGAGCAGGCTGGATGCCCTCCAGCGCCAGCTCAACAG
GCTGGAGACCCGGCTGAGTGCAGACATGGCCACTGTCCTGCAGCTGCTACAGAGGCAGAT
GACGCTGGTCCCGCCCGCCTACAGTGCTGTGACCACCCCGGGGCCTGGCCCCACTTCCAC
ATCCCCGCTGTTGCCCGTCAGCCCCCTCCCCACCCTCACCTTGGACTCGCTTTCTCAGGT
TTCCCAGTTCATGGCGTGTGAGGAGCTGCCCCCGGGGGCCCCAGAGCTTCCCCAAGAAGG
CCCCACACGACGCCTCTCCCTACCGGGCCAGCTGGGGGCCCTCACCTCCCAGCCCCTGCA
CAGACACGGCTCGGACCCGGGCAGTTAGTGGGGCTGCCCAGTGTGGACACGTGGCTCACC
CAGGGATCAAGGCGCTGCTGGGCCGCTCCCCTTGGAGGCCCTGCTCAGGAGGCCCTGACC
GTGGAAGGGGAGAGGAACTCGAAAGCACAGCTCCTCCCCCAGCCCTTGGGACCATCTTCT
CCTGCAGTCCCCTGGGCCCCAGTGAGAGGGGCAGGGGCAGGGCCGGCAGTAGGTGGGGCC
TGTGGTCCCCCCACTGCCCTGAGGGCATTAGCTGGTCTAACTGCCCGGAGGCACCCGGCC
CTGGGCCTTAGGCACCTCAAGGACTTTTCTGCTATTTACTGCTCTTATTGTTAAGGATAA
TAATTAAGGATCATATGAATAATTAATGAAGATGCTGATGACTATGAATAATAAATAATT
ATCCTGAGGAGACTCCAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000238 unedited
NNAAGGTTCGNCATTTGTNATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCCC
GCCCGGCCCGCCCATGGGCTCAGATGCCGGTGCGGAGGGGCCACGTCGCGCCGCAGACAC
CTTCCTGGACACCATCATCCGCAAGTTTGAGGGCCAGAGCCGTAAGTTCATCATCGCCAA
CGCTCGGGTGGAGAACTGCGCCGTCATCTACTGCAACGACGGCTTCTGCGAGCTGTGCGG
CTACTCGCGGGCCGAGGTGATGCAGCGACCCTGCACCTGCGACTTCCTGCACGGGCCGCG
CACGCAGCGCCGCGCTGCCGCGCAGATCGCGCAGGCACTGCTGGGCGCCGAGGAGCGCAA
AGTGGAAATCGCCTTCTACCGGAAAGATGGGAGCTGCTTCCTATGTCTGGTGGATGTGGT
GCCCGTGAAGAACGAGGATGGGGCTGTCATCATGTTCATCCTCAATTTCGAGGTGGTGAT
GGAGAAGGACATGGTGGGGTCCCCGGCTCATGACACCAACCACCGGGGCCCCCCCACCAG
CTGGCTGGCCCCAGGCCGCGCCAAGACCTTCCGCCTGAAGCTGCCCGCGCTGCTGGCGCT
GACGGCCCGGGAGTCGTCGGTGCGGTCGGGCGGCGCGGGCGGCGCGGGCGCCCCGGGGGC
CGTGGTGGTGGACGTGGACCTGACGCCCGCGGCACCCAGCAGCGAGTCGCTGGCCCTGGA
CGAAGTGACAGCCATGGACAACCACGTGGCAGGGCTCGGGCCCGCGGAGGAGCGGCGTGC
GCTGGTGGGTCCCGGCTCTCCGCCCCGCAGCGCGCCCGGCCAGCTCCCATCGCCCCGGGC
GCACAGCCCTCACCCCCGACGCCTCGGGCTCCAGCTGCAGCCTGGCCCGGACGCCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000238 unedited
NCCGGCATGGNGATGGCACTTCCAGGNCCAGNAAAGCACTGGGGNAGGGTCACAGGATGC
CACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTGGAGTCTCCTCAGGATAATTATTTATTATTCATA
GTCATCAGCATCTTCATTAATTATTCATATGATCCTTAATTATTATCCTTAACAATAAGA
GCAGTAAATAGCAGAAAAGTCCTTGAGGTGCCTAAGGCCCAGGGCCGGGTGCCTCCGGGC
AGTTAGACCAGCTAATGCCCTCAGGGCAGTGGGGGGACCACAGGCCCCACCTACTGCCGG
CCCTGCCCCTGCCCCTCTCACTGGGGCCCAGGGGACTGCAGGAGAAGATGGTCCCAAGGG
CTGGGGGAGGAGCTGTGCTTTCGAGTTCCTCTCCCCTTCCACGGTCAGGGCCTCCTGAGC
AGGGCCTCCAAGGGGAGCGGCCCAGCAGCGCCTTGATCCCTGGGTGAGCCACGTGTCCAC
ACTGGGCAGCCCCACTAACTGCCCGGGTCCGAGCCGTGTCTGTGCAGGGGCTGGGAGGTG
AGGGCCCCCANCTGGCCCGGTAGGGAGAGGCGTCCTGTGGGGCCTTCTTGGGGAAGCTCT
GGGGCCCCCGGGGGCAGCTCCTCACACGCCATGAACTGGGAAACCTGAGAAAGCGAGTCC
AAGGTGAGGGTGGGGAGGGGGCTGACGGGCAACAGCGGGGATGTGGAAGTGGGGCCAGGC
CCCGGGGTGGTCACAGCACTGTAGGCGGGCGGGACCAGCGTCATCTGCCTCTGTAGCAGC
TGCAAGACAGTGGCCATGTCTGCACTCAGCCGGGTCTCCAGCCTGTTGA
Tag Tag Free
ACCN NM_000238
ORF Size 3480 bp
Insert Size 4300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000238.2, NP_000229
RefSeq Size 3900
RefSeq ORF 3480
Locus ID 3757
Cytogenetics 7q36.1
Protein Families Ion Channels: Potassium, Transmembrane, Transcription Factors, Druggable Genome
Gene Summary This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.