ErbB 2(ERBB2) (NM_004448) Human Untagged Clone

CAT#: SC128161

ERBB2 (untagged)-Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) (ERBB2), transcript variant 1

USD 2,400.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ErbB 2(ERBB2) (NM_004448) Human Untagged Clone
Symbol ERBB2
Synonyms CD340; HER-2; HER-2/neu; HER2; MLN 19; NEU; NGL; TKR1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_004448 edited
GGGCGGCCGCGAATTCGGCACGAGGGGGCCGGAGCCGCAGTGAGCACCATGGAGCTGGCG
GCCTTGTGCCGCTGGGGGCTCCTCCTCGCCCTCTTGCCCCCCGGAGCCGCGAGCACCCAA
GTGTGCACCGGCACAGACATGAAGCTGCGGCTCCCTGCCAGTCCCGAGACCCACCTGGAC
ATGCTCCGCCACCTCTACCAGGGCTGCCAGGTGGTGCAGGGAAACCTGGAACTCACCTAC
CTGCCCACCAATGCCAGCCTGTCCTTCCTGCAGGATATCCAGGAGGTGCAGGGCTACGTG
CTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGC
ACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAAC
AATACCACCCCTGTCACAGGGGCCTCCCCAGGAGGCCTGCGGGAGCTGCAGCTTCGAAGC
CTCACAGAGATCTTGAAAGGAGGGGTCTTGATCCAGCGGAACCCCCAGCTCTGCTACCAG
GACACGATTTTGTGGAAGGACATCTTCCACAAGAACAACCAGCTGGCTCTCACACTGATA
GACACCAACCGCTCTCGGGCCTGCCACCCCTGTTCTCCGATGTGTAAGGGCTCCCGCTGC
TGGGGAGAGAGTTCTGAGGATTGTCAGAGCCTGACGCGCACTGTCTGTGCCGGTGGCTGT
GCCCGCTGCAAGGGGCCACTGCCCACTGACTGCTGCCATGAGCAGTGTGCTGCCGGCTGC
ACGGGCCCCAAGCACTCTGACTGCCTGGCCTGCCTCCACTTCAACCACAGTGGCATCTGT
GAGCTGCACTGCCCAGCCCTGGTCACCTACAACACAGACACGTTTGAGTCCATGCCCAAT
CCCGAGGGCCGGTATACATTCGGCGCCAGCTGTGTGACTGCCTGTCCCTACAACTACCTT
TCTACGGACGTGGGATCCTGCACCCTCGTCTGCCCCCTGCACAACCAAGAGGTGACAGCA
GAGGATGGAACACAGCGGTGTGAGAAGTGCAGCAAGCCCTGTGCCCGAGTGTGCTATGGT
CTGGGCATGGAGCACTTGCGAGAGGTGAGGGCAGTTACCAGTGCCAATATCCAGGAGTTT
GCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTCTGCCGGAGAGCTTTGATGGGGAC
CCAGCCTCCAACACTGCCCCGCTCCAGCCAGAGCAGCTCCAAGTGTTTGAGACTCTGGAA
GAGATCACAGGTTACCTATACATCTCAGCATGGCCGGACAGCCTGCCTGACCTCAGCGTC
TTCCAGAACCTGCAAGTAATCCGGGGACGAATTCTGCACAATGGCGCCTACTCGCTGACC
CTGCAAGGGCTGGGCATCAGCTGGCTGGGGCTGCGCTCACTGAGGGAACTGGGCAGTGGA
CTGGCCCTCATCCACCATAACACCCACCTCTGCTTCGTGCACACGGTGCCCTGGGACCAG
CTCTTTCGGAACCCGCACCAAGCTCTGCTCCACACTGCCAACCGGCCAGAGGACGAGTGT
GTGGGCGAGGGCCTGGCCTGCCACCAGCTGTGCGCCCGAGGGCACTGCTGGGGTCCAGGG
CCCACCCAGTGTGTCAACTGCAGCCAGTTCCTTCGGGGCCAGGAGTGCGTGGAGGAATGC
CGAGTACTGCAGGGGCTCCCCAGGGAGTATGTGAATGCCAGGCACTGTTTGCCGTGCCAC
CCTGAGTGTCAGCCCCAGAATGGCTCAGTGACCTGTTTTGGACTGGAGGCTGACCAGTGT
GTGGCCTGTGCCCACTATAAGGACCCTCCCTTCTGCGTGGCCCGCTGCCCCAGCGGTGTG
AAACCTGACCTCTCCTACATGCCCATCTGGAAGTTTCCAGATGAGGAGGGCGCATGCCAG
CCTTGCCCCATCAACTGCACCCACTCCTGTGTGGACCTGGATGACAAGGGCTGCCCCGCC
GAGCAGAGAGCCAGCCCTCTGACGTCCATCATCTCTGCGGTGGTTGGCATTCTGCTGGTC
GTGGTCTTGGGGGTGGTCTTTGGGATCCTCATCAAGCGACGGCAGCAGAAGATCCGGAAG
TACACGATGCGGAGACTGCTGCAGGAAACGGAGCTGGTGGAGCCGCTGACACCTAGCGGA
GCGATGCCCAACCAGGCGCAGATGCGGATCCTGAAAGAGACGGAGCTGAGGAAGGTGAAG
GTGCTTGGATCTGGCGCTTTTGGCACAGTCTACAAGGGCATCTGGATCCCTGATGGGGAG
AATGTGAAAATTCCAGTGGCCATCAAAGTGTTGAGGGAAAACACATCCCCCAAAGCCAAC
AAAGAAATCTTAGACGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGC
CTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTGACACAGCTTATGCCCTATGGC
TGCCTCTTAGACCATGTCCGGGAAAACCGCGGACGCCTGGGCTCCCAGGACCTGCTGAAC
TGGTGTATGCAGATTGCCAAGGGGATGAGCTACCTGGAGGATGTGCGGCTCGTACACAGG
GACTTGGCCGCTCGGAACGTGCTGGTCAAGAGTCCCAACCATGTCAAAATTACAGACTTC
GGGCTGGCTCGGCTGCTGGACATTGACGAGACAGAGTACCATGCAGATGGGGGCAAGGTG
CCCATCAAGTGGATGGCGCTGGAGTCCATTCTCCGCCGGCGGTTCACCCACCAGAGTGAT
GTGTGGAGTTATGGTGTGACTGTGTGGGAGCTGATGACTTTTGGGGCCAAACCTTACGAT
GGGATCCCAGCCCGGGAGATCCCTGACCTGCTGGAAAAGGGGGAGCGGCTGCCCCAGCCC
CCCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAA
TGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAG
CGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTC
TACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTG
GTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCAC
CACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAG
CCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGAT
GTATTTGATGGTGACCTGGGAATGGGGGCAGCCAAGGGGCTGCAAAGCCTCCCCACACAT
GACCCCAGCCCTCTACAGCGGTACAGTGAGGACCCCACAGTACCCCTGCCCTCTGAGACT
GATGGCTACGTTGCCCCCCTGACCTGCAGCCCCCAGCCTGAATATGTGAACCAGCCAGAT
GTTCGGCCCCAGCCCCCTTCGCCCCGAGAGGGCCCTCTGCCTGCTGCCCGACCTGCTGGT
GCCACTCTGGAAAGGCCCAAGACTCTCTCCCCAGGGAAGAATGGGGTCGTCAAAGACGTT
TTTGCCTTTGGGGGTGCCGTGGAGAACCCCGAGTACTTGACACCCCAGGGAGGAGCTGCC
CCTCAGCCCCACCCTCCTCCTGCCTTCAGCCCAGCCTTCGACAACCTCTATTACTGGGAC
CAGGACCCACCAGAGCGGGGGGCTCCACCCAGCACCTTCAAAGGGACACCTACGGCAGAG
AACCCAGAGTACCTGGGTCTGGACGTGCCAGTGTGAACCAGAAGGCCAAGTCCGCAGAAG
CCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGAGGTGGGA
GGGCCCTCCGACCACTTCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTT
CCTTCCTGCTTGAGTTCCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAG
CACTGGGGAGTCTTTGTGGATTCTGAGGCCCTGCCCAATGAGACTCTAGGGTCCAGTGGA
TGCCACAGCCCAGCTTGGCCCTCTCCTTCCAGATCCTGGGTACTGAAAGCCTTAGGGAAG
CTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCATTCAG
AGACTGTCCCTGAAACCTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTA
TCCAGGCTTTGTACAGAGTGCTTTTCTGTTTAGTTTTTACTTTTTTTGTTTTGTTTTTTT
AAAGATGAAATAAAGACCCAGGGGGAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004448 unedited
CCCCGTTGCCGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCG
TTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCA
CGAGGGGGCCGGAGCCGCAGTGAGCACCATGGAGCTGGCGGCCTTGTGCCGCTGGGGGCT
CCTCCTCGCCCTCTTGCCCCCCGGAGCCGCGAGCACCCAAGTGTGCACCGGCACAGACAT
GAAGCTGCGGCTCCCTGCCAGTCCCGAGACCCACCTGGACATGCTCCGCCACCTCTACCA
GGGCTGCCAGGTGGTGCAGGGAAACCTGGAACTCACCTACCTGCCCACCAATGCCAGCCT
GTCCTTCCTGCAGGATATCCAGGAGGTGCAGGGCTACGTGCTCATCGCTCACAACCAAGT
GAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAA
CTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAAACATACCACCCCTGTCACAGG
GGCCTCCCCCAGGAGCCTGCGGGAGCTGCAGCTTCGAAGCCTCACAGAGATCCTGAAAGG
AGGGGTCTTGATCCAGCGGGAACCCCCAGCTCTGCTACCCAGACACGATTTTGTGGGAGG
ACATCTTTCCACAGAACACCCAGCTGGCTCTCACACTGATAGACACCAACCGCTCTCGGG
CCCTGCCACCCCCTGTTCTCCGATGTGTAAGGGGCTCCCGCTGCTGGGGGAGAAAATTCT
GAAGGATTGTCAAAACCCTGACCCCCCCCTGGCTGGGCCCGGTGGGCTGTCCCCCCTGCC
AGGGGCCCACTGCCCAATGACCGGCTGGCCAAGAACAATGTGGGCTGCCGCTTGGCCCGG
GCCCCCAAGCACCTCTGAATGGGCTGGGCCTGGCCNCCCATTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004448 unedited
GGAATGGCACTTCCATGCCAGAAGCACTGGGGAGGGTCACAGGGTGCCCCCGGGATCTGT
TAGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTCCTCCCCCTGGGTCTTTATTTCATCTTTAAAAAAACAAAACAAA
AAAAGTAAAAACTAAACAGAAAAAGCACTCTGTACAAAGCCTGGATACTGACACCATTGC
TGTTCCTTCCTCATGGGGGGCAGTACTAGGTTTCAGGGACAGTCTCTGAATGGGTCGCTT
TTGTTCTAAACACTCCCTTAGGGCCGTTTCCCTTCTCAGGCCAGTTTTCCTAAGCTTTTC
ATTCCCCAGATTTGGAAAGAAAAGGGCCAAACTGGCTTTGGGCATTCCATGGACCCCTTA
AATTTTATTTTGGCAGGGCCCTTAAAATCCAAAAAAACTCCCCATGGCTGTTTTTTTTTC
CAAGAAGGTTGGGCCCTTTCCACCCTTTTGGGAACCTCCAGCCGGGAAGAAAGTTTTTTT
TAAAAACAGTTTTCTGGGATGGGGGGTTTCCCCCTAAAAAAGTTCACAAAGCCCCCCCCC
CCCTTTTTTTTTCCCCCCAAAAAAATTAGGGCTTTTTCTTTGTTTTTAGAAGAAAAAAAA
AAAGGGTTTTTTTGGGAAAATTTGCCTTTCTTGGTTGTAAAAAGGGGGGGCCTCAAAAAA
CAAATTTTTCTTTGGTGTTTTTTTTTCCCCCCCAAGGGGGTGCTCTTTCTATAAAGAGAG
GGGGGGGGGGGGAACCCCCCCCCCCCTCTT
Tag Tag Free
ACCN NM_004448
ORF Size 3768 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004448.2, NP_004439
RefSeq Size 4664
Locus ID 2064
Cytogenetics 17q12
Domains Recep_L_domain, pkinase, TyrKc, S_TKc, YLP, Furin-like, FU
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways ErbB signaling pathway, Calcium signaling pathway, Focal adhesion, Adherens junction, Pathways in cancer, Pancreatic cancer, Endometrial cancer, Prostate cancer, Bladder cancer, Non-small cell lung cancer
Gene Summary This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations