JMJD6 (NM_015167) Human Untagged Clone

CAT#: SC127976

Reviews ()
Write a review

JMJD6 (untagged)-Human jumonji domain containing 6 (JMJD6), transcript variant 2



Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol JMJD6
Synonyms PSR; PTDSR; PTDSR1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_015167, the custom clone sequence may differ by one or more nucleotides


ATGAACCACAAGAGCAAGAAGCGCATCCGCGAGGCCAAGCGGAGTGCGCGGCCGGAGCTCAAGGACTCGC
TGGATTGGACCCGGCACAACTACTACGAGAGCTTCTCGCTGAGCCCGGCGGCCGTGGCGGATAACGTGGA
AAGGGCAGATGCTTTACAGCTGTCTGTGGAAGAATTTGTGGAGCGGTATGAAAGACCTTACAAGCCCGTG
GTTTTGTTGAATGCGCAAGAGGGCTGGTCTGCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAAT
ATCGGAACCAGAAGTTCAAGTGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTA
CATCGAGTACATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACAC
CCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTTTTCCAGTATG
CTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCACGCTCCGGAACTGGGATTCA
CATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTTCAGGGCCACAAGCGCTGGTGCCTGTTTCCT
ACCAGCACTCCCAGGGAACTCATCAAAGTGACCCGAGACGAAGGAGGGAACCAGCAAGACGAAGCTATTA
CCTGGTTTAATGTTATTTATCCCCGGACACAGCTTCCAACCTGGCCACCTGAATTCAAACCCCTGGAAAT
CTTACAAAAACCAGGAGAGACTGTCTTTGTACCAGGAGGCTGGTGGCATGTTGTCCTCAATCTCGACACT
ACTATCGCCATCACCCAAAATTTTGCCAGCAGCACCAACTTCCCTGTGGTATGGCACAAGACGGTAAGAG
GGAGACCAAAGTTATCAAGGAAATGGTATAGGATTTTGAAGCAAGAGCACCCCGAGTTGGCAGTCCTCGC
AGACTCGGTTGACCTTCAGGAGTCCACAGGGATAGCTTCCGACAGCTCCAGCGACTCTTCCAGCTCCTCC
AGCTCCAGTTCGTCAGACTCCGACTCAGAGTGCGAGTCTGGATCCGAGGGCGATGGGACAGTGCACCGCA
GGAAGAAGAGGAGGACGTGCAGCATGGTGGGAAACGGGGACACCACCTCCCAGGACGACTGTGTCAGCAA
AGAGCGCAGCTCCTCCAGGTGA


>OriGene 5' read for NM_015167 unedited
TACTATAGGCGGCCGCGACATTCGCACGAGGGAGCGAAGGGCGTTTGGGTACTGCCGTCG
CCGCCGCCCAGGCCGGGGAGGGGTGCGTTAGTGTCAGGAAGCGGGCTGCGCCGAGGTCGT
AGCGGAACCAGCTGGCGACCCCGCAGAATGAACCACAAGAGCAAGAAGCGCATCCGCGAG
GCCAAGCGGAGTGCGCGGCCGGAGCTCAAGGACTCGCTGGATTGGACCCGGCACAACTAC
TACGAGAGCTTCTCGCTGAGCCCGGCGGCCGTGGCGGATAACGTGGAAAGGGCAGATGCT
TTACAGCTGTCTGTGGAAAGATTTGTGGNAGCGGTATGAAAGACCTTACAAGCCGTGGGT
TNTGNTGAATGCGCAAGAAAGGCTGGTCTGCGCAGGAGAAATGGACTCTGGNAGCGCTAN
NAAGGAATATNCGACCAGAAGTCAGTGTGGGNGAGATAACCATGGCACTCANGGAGATGA
AATGAATACTCATCGAGTACATGAGAGCCTCGGATGATGGTCCCCTTACATCTTGACGCA
GCTTTGTGGACACCCTAAAGAAGGAACTTTTGGAGATACAGGGCCCAAAGTTTCACTGAT
GACTTTCCATAGCTGGGGAGAAACGCAGCCCCTACAGGGGGGTTGGGGATGGGCCACCAC
GCTCCGGACTGGGATTACATCGACCTCTGGGACCAGTGCCTGGATGGCCTTANTTCGGGC
CACAGCGCTGGGGCCTGTTTTCTACAGCACTCCCAGGGACTCATCAAGTGACCCGAGACC
AAAGAAGGACCAGCAAGACGAACTTTA
>OriGene 3' genomic read for NM_015167 unedited
CAGGATAGCTTGGGGCAGGGTCACAGGGCATGCCACCCGGGTATCTGTTCAGGAAAACAG
CTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTAAAGACAGAGT
CTCGGTCTGTCACCCAGGCTGGAGTGGCTTGATCTCAGCTCACTGCAACCTCTGCCTCCT
GGGTTCAAGTGATTCTCCTGCCTGAGTTGACCAAGTAGCTGGGAGTACAGGCATGTGCCA
CCACACCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCGTGTTGGCCAGGC
TGGTCTTGAACTCCTGACCTCAAGTGATCCACCTGCCATGGCCTCCCAAAGTGCTGGGAT
TACAGGGGTGACCCACGGCGCCTGGATTTAATTTCCGTACTATGACCCACAGTTTTACAC
CCCCCGCCTGGAGGGTGCAAGCTCACCCACTCTTGCTGCATAGCCCGTTATATTTTGACT
CCTTCCCTTGTTAGGGTAGGTGTGGCACTACCGCTATTTCCCAATCTCAGACTCCCAGAC
CNGCCAGCCGCGTTTAGCAGGATGACGAAGTTGTTTTCCCCCCCCCCCCTCTTTTTTTTC
CCACCCCCCGTNTTTACCCCACCCCCCGCCCGCCTTCTTTTCTGCCCGCCGGGCGTTTTA
ATCACATTGATCCCCGGTTTCCCCATTTTGTGATGGTACCCCGATGTCGATGGGGCCCTT
AAGGAGGTTTAGGAGTTTGGCCCCCCATTTTTGCCCATTAGTAAGGTTCTCCAGTCCCGT
TTTCCCATTCCCGCGTTTTACCCCCGTCTTACCCGGGTATCCACCGCGTTTTTGCGATTG
GTGGATCACACCTTGCGTTTGCACCCCCCCCCCTTCCTCATT
Restriction Sites NotI-NotI     
ACCN NM_015167
Insert Size 5650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015167.1, NP_055982.1
RefSeq Size 1834 bp
RefSeq ORF 1119 bp
Locus ID 23210
UniProt ID Q6NYC1
Cytogenetics 17q25.1
Domains JmjC
Protein Families Druggable Genome, ES Cell Differentiation/IPS
Gene Summary This gene encodes a nuclear protein with a JmjC domain. JmjC domain-containing proteins are predicted to function as protein hydroxylases or histone demethylases. This protein was first identified as a putative phosphatidylserine receptor involved in phagocytosis of apoptotic cells; however, subsequent studies have indicated that it does not directly function in the clearance of apoptotic cells, and questioned whether it is a true phosphatidylserine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region and an alternate polyadenylation site, compared to variant 1. The resulting protein (isoform 2) has a shorter C-terminus, compared to isoform 1.
Other products for "JMJD6"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.