Interferon beta(IFNB1) (NM_002176) Human Untagged Clone

CAT#: SC127861

IFNB1 (untagged)-Human interferon, beta 1, fibroblast (IFNB1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Interferon beta(IFNB1) (NM_002176) Human Untagged Clone
Symbol IFNB1
Synonyms IFB; IFF; IFNB
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127861 sequence for NM_002176 edited (data generated by NextGen Sequencing)
ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTT
TCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAG
CTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAGGATGAACTTTGAC
ATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGGAGGACGCCGCATTGACCATC
TATGAGATGCTCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGG
AATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAG
ACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGT
CTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGT
CACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGA
CTTACAGGTTACCTCCGAAACTGA

Clone variation with respect to NM_002176.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002176 unedited
AAAAGGGTTGCTATTGTAAACGACTCCCTAAGGGCGGCCGCCGAATTCGTCAACATGACC
CACCAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCAATACGCCCTTTCCAGAGC
TTCAACCTGCTTGGATTCCTACAAAGAAGCCGCAACTTTCAGTGTCAGAAGCTCCTGTGG
CAATATGAACGGGAGGCCTTGAATACTGCCTCAAGGACAGGATGAACTTTGACCTCCCTG
AGGAAGCTTTGCAGCCGCAGCAGTTCCAGAAGGAGGACGCCCGCATTGACCATCTATGAG
ATGCTCCAGAACATCTTTGCTATTTTCAGACCAAGATTCATCTAGCACTGGCTGGAATTG
AGACTATTGTTGAGAACCTTCCTTGGCTTATGTCTATCATCAGATAAACCCATTCTTGAA
GCCAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTTCACCAGGGGAAAACTCTTGAGCC
GTCTGCACCTTGAAAAGATATTATTGGGAGGATTCCTGCATTACCTGAAGGCCAAAGGAG
TACCAGTCACCTTGTGCCTGGACCATAATCAGAGTGGAAATCCTAAGGGAACCTTTTACT
TTCATTAACAGAACTTACAGGTTACCTCCGAAACTGAAGATCTCCTAACCTGTGCCTCTG
GGACTGGACAATTGCTTCAAGCATTCTTCAACCAGCAGATGCTNGTTAAGTGACTGATGG
CTCGACTCTAGNATTGCGACGCNGTCATAGCTGATTACTGAACGATCCCCGGTGGGCATC
CTGTGACCCTNCCCAGTGCCTCTCTGGGCCTGGGAGTTTGCACTCCAGTGCCCACAGCCC
TTGTCTAATAAAATTAAGTGCATCATTTTGTCTGACATAGTGTCCTCTTAATATGGTGGN
NGGGGGGGGGGGGGGNNNNNNNNNNNNGGGGNNNNNTTTAAAAAAAACAACTGGGGGGCG
A
3' Read Nucleotide Sequence
>OriGene 3' genomic read for NM_002176 unedited
CCAAATCCATTAAACGCATCTGCTGGTTGAAGAATGCTTGAAGCAATTGTCCAGTCCCAG
AGGCACAGGCTAGGAGATCTTCAGTTTCGGAGGTAACCTGTAAGTCTGTTAATGAAGTAA
AAGTTCCTTAGGATTTCCACTCTGACTATGGTCCAGGCACAGTGACTGTACTCCTTGGCT
TTTATGTAATGCAGAATCCTCCCATAATATCTTTTCAGGTGCAGACTGCTCATGAGTTTT
CCCCTGGTGAAATCTTCTTTCTCCAGTTTTTCTTCCAGGACTGTCTTCAGATGGTTTATC
TGATGATAGACATTAGCCAGGAGGTTCTCAACAATAGTCTCATTCCAGCCAGTGCTAGAT
GAATCTTGTCTGAAAATAGCAAAGATGTTCTGGAGCATCTCATAGATGGTCAATGCGGCG
TCCTCCTTCTGGAACTGCTGCAGCTGCTTAATCTCCTCAGGGATGTCAAAGTTCATCCTG
TCCTTGAGGCAGTATTCAAGCCTCCCATTCAATTGCCACAGGAGCTTCTGACACTGAAAA
TTGCTGCTTCTTTGTAGGAATCCAAGCAAGTTGTAGCTCATGGAAAGAGCTGTAGTGGAG
AAGCACAACAGGAGAGCAATTTGGAGGAGACACTTGTTGGTCATGTTGACGAATTCGCGG
CCGCCCTATAGTGAGTCGTATTACAAAATTCTGACGGTTCACTAAACGAGCTCTGCTTAT
ATAGACCTCCCACCGTACACGCCTACCGNCCATTTGCGTCAACGGGGCGGGGTTATTACG
ACATTTTTGGAAAGTCCCGTTGATTTTTGGTGCCCAACAAACTCCCCATGACGTCCATGG
GGTGGAGACTTTGGAATCCCCGTGAGTCAAA
Tag Tag Free
ACCN NM_002176
ORF Size 564 bp
Insert Size 750
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002176.2, NP_002167
RefSeq Size 840
Locus ID 3456
Cytogenetics 9p21.3
Protein Families Secreted Protein, Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Toll-like receptor signaling pathway, RIG-I-like receptor signaling pathway, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity
Gene Summary Has antiviral, antibacterial and anticancer activities. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.