APC (NM_000038) Human Untagged Clone

CAT#: SC127859

APC (untagged)-Human adenomatous polyposis coli (APC), transcript variant 3

USD 5,429


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name APC (NM_000038) Human Untagged Clone
Symbol APC
Synonyms BTPS2; DP2; DP2.5; DP3; GS; PPP1R46
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127859 sequence for NM_000038 edited (data generated by NextGen Sequencing)
ATGGCTGCAGCTTCATATGATCAGTTGTTAAAGCAAGTTGAGGCACTGAAGATGGAGAAC
TCAAATCTTCGACAAGAGCTAGAAGATAATTCCAATCATCTTACAAAACTGGAAACTGAG
GCATCTAATATGAAGGAAGTACTTAAACAACTACAAGGAAGTATTGAAGATGAAGCTATG
GCTTCTTCTGGACAGATTGATTTATTAGAGCGTCTTAAAGAGCTTAACTTAGATAGCAGT
AATTTCCCTGGAGTAAAACTGCGGTCAAAAATGTCCCTCCGTTCTTATGGAAGCCGGGAA
GGATCTGTATCAAGCCGTTCTGGAGAGTGCAGTCCTGTTCCTATGGGTTCATTTCCAAGA
AGAGGGTTTGTAAATGGAAGCAGAGAAAGTACTGGATATTTAGAAGAACTTGAGAAAGAG
AGGTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAAAGGAAAAAGACTGGTATTACGCT
CAACTTCAGAATCTCACTAAAAGAATAGATAGTCTTCCTTTAACTGAAAATTTTTCCTTA
CAAACAGATATGACCAGAAGGCAATTGGAATATGAAGCAAGGCAAATCAGAGTTGCGATG
GAAGAACAACTAGGTACCTGCCAGGATATGGAAAAACGAGCACAGCGAAGAATAGCCAGA
ATTCAGCAAATCGAAAAGGACATACTTCGTATACGACAGCTTTTACAGTCCCAAGCAACA
GAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAG
AATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCA
ACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCA
CCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG
GCCAGGGCCAGTGCAGCACTCCACAACATCATTCACTCACAGCCTGATGACAAGAGAGGC
AGGCGTGAAATCCGAGTCCTTCATCTTTTGGAACAGATACGCGCTTACTGTGAAACCTGT
TGGGAGTGGCAGGAAGCTCATGAACCAGGCATGGACCAGGACAAAAATCCAATGCCAGCT
CCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTTGATGAA
GAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTATTGCAA
GTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGACGATAT
GCTGGAATGGCTTTGACAAACTTGACTTTTGGAGATGTAGCCAACAAGGCTACGCTATGC
TCTATGAAAGGCTGCATGAGAGCACTTGTGGCCCAACTAAAATCTGAAAGTGAAGACTTA
CAGCAGGTTATTGCGAGTGTTTTGAGGAATTTGTCTTGGCGAGCAGATGTAAATAGTAAA
AAGACGTTGCGAGAAGTTGGAAGTGTGAAAGCATTGATGGAATGTGCTTTAGAAGTTAAA
AAGGAATCAACCCTCAAAAGCGTATTGAGTGCCTTATGGAATTTGTCAGCACATTGCACT
GAGAATAAAGCTGATATATGTGCTGTAGATGGTGCACTTGCATTTTTGGTTGGCACTCTT
ACTTACCGGAGCCAGACAAACACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGG
AATGTGTCCAGCTTGATAGCTACAAATGAGGACCACAGGCAAATCCTAAGAGAGAACAAC
TGTCTACAAACTTTATTACAACACTTAAAATCTCATAGTTTGACAATAGTCAGTAATGCA
TGTGGAACTTTGTGGAATCTCTCAGCAAGAAATCCTAAAGACCAGGAAGCATTATGGGAC
ATGGGGGCAGTTAGCATGCTCAAGAACCTCATTCATTCAAAGCACAAAATGATTGCTATG
GGAAGTGCTGCAGCTTTAAGGAATCTCATGGCAAATAGGCCTGCGAAGTACAAGGATGCC
AATATTATGTCTCCTGGCTCAAGCTTGCCATCTCTTCATGTTAGGAAACAAAAAGCCCTA
GAAGCAGAATTAGATGCTCAGCACTTATCAGAAACTTTTGACAATATAGACAATTTAAGT
CCCAAGGCATCTCATCGTAGTAAGCAGAGACACAAGCAAAGTCTCTATGGTGATTATGTT
TTTGACACCAATCGACATGATGATAATAGGTCAGACAATTTTAATACTGGCAACATGACT
GTCCTTTCACCATATTTGAATACTACAGTGTTACCCAGCTCCTCTTCATCAAGAGGAAGC
TTAGATAGTTCTCGTTCTGAAAAAGATAGAAGTTTGGAGAGAGAACGCGGAATTGGTCTA
GGCAACTACCATCCAGCAACAGAAAATCCAGGAACTTCTTCAAAGCGAGGTTTGCAGATC
TCCACCACTGCAGCCCAGATTGCCAAAGTCATGGAAGAAGTGTCAGCCATTCATACCTCT
CAGGAAGACAGAAGTTCTGGGTCTACCACTGAATTACATTGTGTGACAGATGAGAGAAAT
GCACTTAGAAGAAGCTCTGCTGCCCATACACATTCAAACACTTACAATTTCACTAAGTCG
GAAAATTCAAATAGGACATGTTCTATGCCTTATGCCAAATTAGAATACAAGAGATCTTCA
AATGATAGTTTAAATAGTGTCAGTAGTAGTGATGGTTATGGTAAAAGAGGTCAAATGAAA
CCCTCGATTGAATCCTATTCTGAAGATGATGAAAGTAAGTTTTGCAGTTATGGTCAATAC
CCAGCCGACCTAGCCCATAAAATACATAGTGCAAATCATATGGATGATAATGATGGAGAA
CTAGATACACCAATAAATTATAGTCTTAAATATTCAGATGAGCAGTTGAACTCTGGAAGG
CAAAGTCCTTCACAGAATGAAAGATGGGCAAGACCCAAACACATAATAGAAGATGAAATA
AAACAAAGTGAGCAAAGACAATCAAGGAATCAAAGTACAACTTATCCTGTTTATACTGAG
AGCACTGATGATAAACACCTCAAGTTCCAACCACATTTTGGACAGCAGGAATGTGTTTCT
CCATACAGGTCACGGGGAGCCAATGGTTCAGAAACAAATCGAGTGGGTTCTAATCATGGA
ATTAATCAAAATGTAAGCCAGTCTTTGTGTCAAGAAGATGACTATGAAGATGATAAGCCT
ACCAATTATAGTGAACGTTACTCTGAAGAAGAACAGCATGAAGAAGAAGAGAGACCAACA
AATTATAGCATAAAATATAATGAAGAGAAACGTCATGTGGATCAGCCTATTGATTATAGT
TTAAAATATGCCACAGATATTCCTTCATCACAGAAACAGTCATTTTCATTCTCAAAGAGT
TCATCTGGACAAAGCAGTAAAACCGAACATATGTCTTCAAGCAGTGAGAATACGTCCACA
CCTTCATCTAATGCCAAGAGGCAGAATCAGCTCCATCCAAGTTCTGCACAGAGTAGAAGT
GGTCAGCCTCAAAAGGCTGCCACTTGCAAAGTTTCTTCTATTAACCAAGAAACAATACAG
ACTTATTGTGTAGAAGATACTCCAATATGTTTTTCAAGATGTAGTTCATTATCATCTTTG
TCATCAGCTGAAGATGAAATAGGATGTAATCAGACGACACAGGAAGCAGATTCTGCTAAT
ACCCTGCAAATAGCAGAAATAAAAGAAAAGATTGGAACTAGGTCAGCTGAAGATCCTGTG
AGCGAAGTTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAGCAGACTGCAGGGTTCT
AGTTTATCTTCAGAATCAGCCAGGCACAAAGCTGTTGAATTTTCTTCAGGAGCGAAATCT
CCCTCCAAAAGTGGTGCTCAGACACCCAAAAGTCCACCTGAACACTATGTTCAGGAGACC
CCACTCATGTTTAGCAGATGTACTTCTGTCAGTTCACTTGATAGTTTTGAGAGTCGTTCG
ATTGCCAGCTCCGTTCAGAGTGAACCATGCAGTGGAATGGTAAGTGGCATTATAAGCCCC
AGTGATCTTCCAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAGTAAAACACCTCCA
CCACCTCCTCAAACAGCTCAAACCAAGCGAGAAGTACCTAAAAATAAAGCACCTACTGCT
GAAAAGAGAGAGAGTGGACCTAAGCAAGCTGCAGTAAATGCTGCAGTTCAGAGGGTCCAG
GTTCTTCCAGATGCTGATACTTTATTACATTTTGCCACGGAAAGTACTCCAGATGGATTT
TCTTGTTCATCCAGCCTGAGTGCTCTGAGCCTCGATGAGCCATTTATACAGAAAGATGTG
GAATTAAGAATAATGCCTCCAGTTCAGGAAAATGACAATGGGAATGAAACAGAATCAGAG
CAGCCTAAAGAATCAAATGAAAACCAAGAGAAAGAGGCAGAAAAAACTATTGATTCTGAA
AAGGACCTATTAGATGATTCAGATGATGATGATATTGAAATACTAGAAGAATGTATTATT
TCTGCCATGCCAACAAAGTCATCACGTAAAGCAAAAAAGCCAGCCCAGACTGCTTCAAAA
TTACCTCCACCTGTGGCAAGGAAACCAAGTCAGCTGCCTGTGTACAAACTTCTACCATCA
CAAAACAGGTTGCAACCCCAAAAGCATGTTAGTTTTACACCGGGGGATGATATGCCACGG
GTGTATTGTGTTGAAGGGACACCTATAAACTTTTCCACAGCTACATCTCTAAGTGATCTA
ACAATCGAATCCCCTCCAAATGAGTTAGCTGCTGGAGAAGGAGTTAGAGGAGGGGCACAG
TCAGGTGAATTTGAAAAACGAGATACCATTCCTACAGAAGGCAGAAGTACAGATGAGGCT
CAAGGAGGAAAAACCTCATCTGTAACCATACCTGAATTGGATGACAATAAAGCAGAGGAA
GGTGATATTCTTGCAGAATGCATTAATTCTGCTATGCCCAAAGGGAAAAGTCACAAGCCT
TTCCGTGTGAAAAAGATAATGGACCAGGTCCAGCAAGCATCTGCGTCTTCTTCTGCACCC
AACAAAAATCAGTTAGATGGTAAGAAAAAGAAACCAACTTCACCAGTAAAACCTATACCA
CAAAATACTGAATATAGGACACGTGTAAGAAAAAATGCAGACTCAAAAAATAATTTAAAT
GCTGAGAGAGTTTTCTCAGACAACAAAGATTCAAAGAAACAGAATTTGAAAAATAATTCC
AAGGACTTCAATGATAAGCTCCCAAATAATGAAGATAGAGTCAGAGGAAGTTTTGCTTTT
GATTCACCTCATCATTACACGCCTATTGAAGGAACTCCTTACTGTTTTTCACGAAATGAT
TCTTTGAGTTCTCTAGATTTTGATGATGATGATGTTGACCTTTCCAGGGAAAAGGCTGAA
TTAAGAAAGGCAAAAGAAAATAAGGAATCAGAGGCTAAAGTTACCAGCCACACAGAACTA
ACCTCCAACCAACAATCAGCTAATAAGACACAAGCTATTGCAAAGCAGCCAATAAATCGA
GGTCAGCCTAAACCCATACTTCAGAAACAATCCACTTTTCCCCAGTCATCCAAAGACATA
CCAGACAGAGGGGCAGCAACTGATGAAAAGTTACAGAATTTTGCTATTGAAAATACTCCG
GTTTGCTTTTCTCATAATTCCTCTCTGAGTTCTCTCAGTGACATTGACCAAGAAAACAAC
AATAAAGAAAATGAACCTATCAAAGAGACTGAGCCCCCTGACTCACAGGGAGAACCAAGT
AAACCTCAAGCATCAGGCTATGCTCCTAAATCATTTCATGTTGAAGATACCCCAGTTTGT
TTCTCAAGAAACAGTTCTCTCAGTTCTCTTAGTATTGACTCTGAAGATGACCTGTTGCAG
GAATGTATAAGCTCCGCAATGCCAAAAAAGAAAAAGCCTTCAAGACTCAAGGGTGATAAT
GAAAAACATAGTCCCAGAAATATGGGTGGCATATTAGGTGAAGATCTGACACTTGATTTG
AAAGATATACAGAGACCAGATTCAGAACATGGTCTATCCCCTGATTCAGAAAATTTTGAT
TGGAAAGCTATTCAGGAAGGTGCAAATTCCATAGTAAGTAGTTTACATCAAGCTGCTGCT
GCTGCATGTTTATCTAGACAAGCTTCGTCTGATTCAGATTCCATCCTTTCCCTGAAATCA
GGAATCTCTCTGGGATCACCATTTCATCTTACACCTGATCAAGAAGAAAAACCCTTTACA
AGTAATAAAGGCCCACGAATTCTAAAACCAGGGGAGAAAAGTACATTGGAAACTAAAAAG
ATAGAATCTGAAAGTAAAGGAATCAAAGGAGGAAAAAAAGTTTATAAAAGTTTGATTACT
GGAAAAGTTCGATCTAATTCAGAAATTTCAGGCCAAATGAAACAGCCCCTTCAAGCAAAC
ATGCCTTCAATCTCTCGAGGCAGGACAATGATTCATATTCCAGGAGTTCGAAATAGCTCC
TCAAGTACAAGTCCTGTTTCTAAAAAAGGCCCACCCCTTAAGACTCCAGCCTCCAAAAGC
CCTAGTGAAGGTCAAACAGCCACCACTTCTCCTAGAGGAGCCAAGCCATCTGTGAAATCA
GAATTAAGCCCTGTTGCCAGGCAGACATCCCAAATAGGTGGGTCAAGTAAAGCACCTTCT
AGATCAGGATCTAGAGATTCGACCCCTTCAAGACCTGCCCAGCAACCATTAAGTAGACCT
ATACAGTCTCCTGGCCGAAACTCAATTTCCCCTGGTAGAAATGGAATAAGTCCTCCTAAC
AAATTATCTCAACTTCCAAGGACATCATCCCCTAGTACTGCTTCAACTAAGTCCTCAGGT
TCTGGAAAAATGTCATATACATCTCCAGGTAGACAGATGAGCCAACAGAACCTTACCAAA
CAAACAGGTTTATCCAAGAATGCCAGTAGTATTCCAAGAAGTGAGTCTGCCTCCAAAGGA
CTAAATCAGATGAATAATGGTAATGGAGCCAATAAAAAGGTAGAACTTTCTAGAATGTCT
TCAACTAAATCAAGTGGAAGTGAATCTGATAGATCAGAAAGACCTGTATTAGTACGCCAG
TCAACTTTCATCAAAGAAGCTCCAAGCCCAACCTTAAGAAGAAAATTGGAGGAATCTGCT
TCATTTGAATCTCTTTCTCCATCATCTAGACCAGCTTCTCCCACTAGGTCCCAGGCACAA
ACTCCAGTTTTAAGTCCTTCCCTTCCTGATATGTCTCTATCCACACATTCGTCTGTTCAG
GCTGGTGGATGGCGAAAACTCCCACCTAATCTCAGTCCCACTATAGAGTATAATGATGGA
AGACCAGCAAAGCGCCATGATATTGCACGGTCTCATTCTGAAAGTCCTTCTAGACTTCCA
ATCAATAGGTCAGGAACCTGGAAACGTGAGCACAGCAAACATTCATCATCCCTTCCTCGA
GTAAGCACTTGGAGAAGAACTGGAAGTTCATCTTCAATTCTTTCTGCTTCATCAGAATCC
AGTGAAAAAGCAAAAAGTGAGGATGAAAAACATGTGAACTCTATTTCAGGAACCAAACAA
AGTAAAGAAAACCAAGTATCCGCAAAAGGAACATGGAGAAAAATAAAAGAAAATGAATTT
TCTCCCACAAATAGTACTTCTCAGACCGTTTCCTCAGGTGCTACAAATGGTGCTGAATCA
AAGACTCTAATTTATCAAATGGCACCTGCTGTTTCTAAAACAGAGGATGTTTGGGTGAGA
ATTGAGGACTGTCCCATTAACAATCCTAGATCTGGAAGATCTCCCACAGGTAATACTCCC
CCGGTGATTGACAGTGTTTCAGAAAAGGCAAATCCAAACATTAAAGATTCAAAAGATAAT
CAGGCAAAACAAAATGTGGGTAATGGCAGTGTTCCCATGCGTACCGTGGGTTTGGAAAAT
CGCCTGAACTCCTTTATTCAGGTGGATGCCCCTGACCAAAAAGGAACTGAGATAAAACCA
GGACAAAATAATCCTGTCCCTGTATCAGAGACTAATGAAAGTTCTATAGTGGAACGTACC
CCATTCAGTTCTAGCAGCTCAAGCAAACACAGTTCACCTAGTGGGACTGTTGCTGCCAGA
GTGACTCCTTTTAATTACAACCCAAGCCCTAGGAAAAGCAGCGCAGATAGCACTTCAGCT
CGGCCATCTCAGATCCCAACTCCAGTGAATAACAACACAAAGAAGCGAGATTCCAAAACT
GACAGCACAGAATCCAGTGGAACCCAAAGTCCTAAGCGCCATTCTGGGTCTTACCTTGTG
ACATCTGTTTAA

Clone variation with respect to NM_000038.5
5465 t=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000038 unedited
CGAGAGACTATAGGGCGGCCGCGAATTCGGCACGAGGTGGAGGTGCTGCCGGACTCGGAA
ATGGGGTCCAAGGGTAGCCAAGGATGGCTGCAGCTTCATATGATCAGTTGTTAAAGCAAG
TTGAGGCACTGAAGATGGAGAACTCAAATCTTCGACAAGAGCTAGAAGATAATTCCAATC
ATCTTACAAAACTGGAAACTGAGGCATCTAATATGAAGGAAGTACTTAAACAACTACAAG
GAAGTATTGAAGATGAAGCTATGGCTTCTTCTGGACAGATTGATTTATTAGAGCGTCTTA
AAGAGCTTAACTTAGATAGCAGTAATTTCCCTGGAGTAAAACTGCGGTCAAAAATGTCCC
TCCGTTCTTATGGAAGCCGGGAAGGATCTGTATCAAGCCGTTCTGGAGAGTGCAGTCCTG
TTCCTATGGGTTCATTTCCAAGAAGAGGGTTTGTAAATGGAAGCAGAGAAAGTACTGGAT
ATTTAGAAGAACTTGAGAAAGAGAGGTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAA
AGGAAAAAGACTGGTATTACGCTCAACTTCAGAATCTCACTAANAGAATAGATAGTCTTC
CTTTAACTGAAAATTTTTCCTTACAAACAGATATGACCAGAAGGCAATTGAATATTAAGC
AGGGCAATCAAATTTGCATGGAGAACCATTGGGCCTGTGCCGGTATTGAAAACAGCCACC
GANAATGCCCAAATTCACATCGAAGGGAATCTTGTTCGAGACTTAAGGCCAACACGAGCA
AGGGTCTTCAACACTGACCGTCCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000038 unedited
TTTGAGCTCGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATCTGTTCAGG
AAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGCATGT
ATCTCCATTGTTTATGGAAGCCTGGGAAAACAACAGAAGTAGATGGTATTCATAGACAAT
TTCAGATAACATTTGGCAAAAATTTAAAGGTCAATCATTTCAAAGATAGTAAATTGAAGT
GTTTACAAAGTGGTGCAGTAGACACAGTACAGGCATTGGAGTCAAATATCTTAGCTCAAG
TCATAGCACTTTTATTTACTGGCATTTTAGCTTTAAAAAAAATCATTCTCATTACCTGGA
AGTTATAAACACAGGTAAGGGGTAGATAATTAACTACTTGATGTGATTTTCAAGGCACCA
GGTAGGTGTATTCACTCCTATCTGAGTGCCCCACCATGCTTAAAAAGGTTTTCCCTCCCC
AAATACAGAGTGTATGAATCTTATCACTAAAAATAAATTTTCATTTATTCAACAAATATG
TATGCATGTATCATCAGTCACCCTCTGATCTTTTAAAACAAATCAGGGAAGATATATTAA
GTGAAATTATCTTAATTAATAAGGTGTCAGTTTATTTTCCTTTCAGAAGGAAGACTTCCC
TTCCCTTGGTTAAAGGGACACCTTAAACTGGTCCCCCCGAAATTGTGCCCTACCACAAAT
AAAGGTTTTCCTAAAAAGGCCGGGGGTTCTAAAAAATTACCTTTCGGGAAATTCTAAACG
GAATTATAAACCCCCCCCACAAGATCCCCGGGGGATTTGAAATATTCTCGCACGGGCCAG
AAGGCGGTATCTTCTCTCCGCTGGCGGAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000038
ORF Size 8532 bp
Insert Size 11000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000038.3, NP_000029
RefSeq Size 10719
RefSeq ORF 8532
Locus ID 324
Cytogenetics 5q22.2
Domains ARM
Protein Families Druggable Genome
Protein Pathways Wnt signaling pathway, Regulation of actin cytoskeleton, Pathways in cancer, Colorectal cancer, Endometrial cancer, Basal cell carcinoma
Gene Summary This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also contains an alternate in-frame exon compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is longer than isoform a. Variants 2 and 3 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.