Topoisomerase II alpha(TOP2A) (NM_001067) Human Untagged Clone

CAT#: SC127832

TOP2A (untagged)-Human topoisomerase (DNA) II alpha 170kDa (TOP2A)

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Topoisomerase II alpha(TOP2A) (NM_001067) Human Untagged Clone
Symbol TOP2A
Synonyms TOP2; TP2A
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC127832 representing NM_001067
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGTGTCACCATTGCAGCCTGTAAATGAAAATATGCAAGTCAACAAAATAAAGAAAAATGAAGATG
CTAAGAAAAGACTGTCTGTTGAAAGAATCTATCAAAAGAAAACACAATTGGAACATATTTTGCTCCGCCC
AGACACCTACATTGGTTCTGTGGAATTAGTGACCCAGCAAATGTGGGTTTACGATGAAGATGTTGGCATT
AACTATAGGGAAGTCACTTTTGTTCCTGGTTTGTACAAAATCTTTGATGAGATTCTAGTTAATGCTGCGG
ACAACAAACAAAGGGACCCAAAAATGTCTTGTATTAGAGTCACAATTGATCCGGAAAACAATTTAATTAG
TATATGGAATAATGGAAAAGGTATTCCTGTTGTTGAACACAAAGTTGAAAAGATGTATGTCCCAGCTCTC
ATATTTGGACAGCTCCTAACTTCTAGTAACTATGATGATGATGAAAAGAAAGTGACAGGTGGTCGAAATG
GCTATGGAGCCAAATTGTGTAACATATTCAGTACCAAATTTACTGTGGAAACAGCCAGTAGAGAATACAA
GAAAATGTTCAAACAGACATGGATGGATAATATGGGAAGAGCTGGTGAGATGGAACTCAAGCCCTTCAAT
GGAGAAGATTATACATGTATCACCTTTCAGCCTGATTTGTCTAAGTTTAAAATGCAAAGCCTGGACAAAG
ATATTGTTGCACTAATGGTCAGAAGAGCATATGATATTGCTGGATCCACCAAAGATGTCAAAGTCTTTCT
TAATGGAAATAAACTGCCAGTAAAAGGATTTCGTAGTTATGTGGACATGTATTTGAAGGACAAGTTGGAT
GAAACTGGTAACTCCTTGAAAGTAATACATGAACAAGTAAACCACAGGTGGGAAGTGTGTTTAACTATGA
GTGAAAAAGGCTTTCAGCAAATTAGCTTTGTCAACAGCATTGCTACATCCAAGGGTGGCAGACATGTTGA
TTATGTAGCTGATCAGATTGTGACTAAACTTGTTGATGTTGTGAAGAAGAAGAACAAGGGTGGTGTTGCA
GTAAAAGCACATCAGGTGAAAAATCACATGTGGATTTTTGTAAATGCCTTAATTGAAAACCCAACCTTTG
ACTCTCAGACAAAAGAAAACATGACTTTACAACCCAAGAGCTTTGGATCAACATGCCAATTGAGTGAAAA
ATTTATCAAAGCTGCCATTGGCTGTGGTATTGTAGAAAGCATACTAAACTGGGTGAAGTTTAAGGCCCAA
GTCCAGTTAAACAAGAAGTGTTCAGCTGTAAAACATAATAGAATCAAGGGAATTCCCAAACTCGATGATG
CCAATGATGCAGGGGGCCGAAACTCCACTGAGTGTACGCTTATCCTGACTGAGGGAGATTCAGCCAAAAC
TTTGGCTGTTTCAGGCCTTGGTGTGGTTGGGAGAGACAAATATGGGGTTTTCCCTCTTAGAGGAAAAATA
CTCAATGTTCGAGAAGCTTCTCATAAGCAGATCATGGAAAATGCTGAGATTAACAATATCATCAAGATTG
TGGGTCTTCAGTACAAGAAAAACTATGAAGATGAAGATTCATTGAAGACGCTTCGTTATGGGAAGATAAT
GATTATGACAGATCAGGACCAAGATGGTTCCCACATCAAAGGCTTGCTGATTAATTTTATCCATCACAAC
TGGCCCTCTCTTCTGCGACATCGTTTTCTGGAGGAATTTATCACTCCCATTGTAAAGGTATCTAAAAACA
AGCAAGAAATGGCATTTTACAGCCTTCCTGAATTTGAAGAGTGGAAGAGTTCTACTCCAAATCATAAAAA
ATGGAAAGTCAAATATTACAAAGGTTTGGGCACCAGCACATCAAAGGAAGCTAAAGAATACTTTGCAGAT
ATGAAAAGACATCGTATCCAGTTCAAATATTCTGGTCCTGAAGATGATGCTGCTATCAGCCTGGCCTTTA
GCAAAAAACAGATAGATGATCGAAAGGAATGGTTAACTAATTTCATGGAGGATAGAAGACAACGAAAGTT
ACTTGGGCTTCCTGAGGATTACTTGTATGGACAAACTACCACATATCTGACATATAATGACTTCATCAAC
AAGGAACTTATCTTGTTCTCAAATTCTGATAACGAGAGATCTATCCCTTCTATGGTGGATGGTTTGAAAC
CAGGTCAGAGAAAGGTTTTGTTTACTTGCTTCAAACGGAATGACAAGCGAGAAGTAAAGGTTGCCCAATT
AGCTGGATCAGTGGCTGAAATGTCTTCTTATCATCATGGTGAGATGTCACTAATGATGACCATTATCAAT
TTGGCTCAGAATTTTGTGGGTAGCAATAATCTAAACCTCTTGCAGCCCATTGGTCAGTTTGGTACCAGGC
TACATGGTGGCAAGGATTCTGCTAGTCCACGATACATCTTTACAATGCTCAGCTCTTTGGCTCGATTGTT
ATTTCCACCAAAAGATGATCACACGTTGAAGTTTTTATATGATGACAACCAGCGTGTTGAGCCTGAATGG
TACATTCCTATTATTCCCATGGTGCTGATAAATGGTGCTGAAGGAATCGGTACTGGGTGGTCCTGCAAAA
TCCCCAACTTTGATGTGCGTGAAATTGTAAATAACATCAGGCGTTTGATGGATGGAGAAGAACCTTTGCC
AATGCTTCCAAGTTACAAGAACTTCAAGGGTACTATTGAAGAACTGGCTCCAAATCAATATGTGATTAGT
GGTGAAGTAGCTATTCTTAATTCTACAACCATTGAAATCTCAGAGCTTCCCGTCAGAACATGGACCCAGA
CATACAAAGAACAAGTTCTAGAACCCATGTTGAATGGCACCGAGAAGACACCTCCTCTCATAACAGACTA
TAGGGAATACCATACAGATACCACTGTGAAATTTGTTGTGAAGATGACTGAAGAAAAACTGGCAGAGGCA
GAGAGAGTTGGACTACACAAAGTCTTCAAACTCCAAACTAGTCTCACATGCAACTCTATGGTGCTTTTTG
ACCACGTAGGCTGTTTAAAGAAATATGACACGGTGTTGGATATTCTAAGAGACTTTTTTGAACTCAGACT
TAAATATTATGGATTAAGAAAAGAATGGCTCCTAGGAATGCTTGGTGCTGAATCTGCTAAACTGAATAAT
CAGGCTCGCTTTATCTTAGAGAAAATAGATGGCAAAATAATCATTGAAAATAAGCCTAAGAAAGAATTAA
TTAAAGTTCTGATTCAGAGGGGATATGATTCGGATCCTGTGAAGGCCTGGAAAGAAGCCCAGCAAAAGGT
TCCAGATGAAGAAGAAAATGAAGAGAGTGACAACGAAAAGGAAACTGAAAAGAGTGACTCCGTAACAGAT
TCTGGACCAACCTTCAACTATCTTCTTGATATGCCCCTTTGGTATTTAACCAAGGAAAAGAAAGATGAAC
TCTGCAGGCTAAGAAATGAAAAAGAACAAGAGCTGGACACATTAAAAAGAAAGAGTCCATCAGATTTGTG
GAAAGAAGACTTGGCTACATTTATTGAAGAATTGGAGGCTGTTGAAGCCAAGGAAAAACAAGATGAACAA
GTCGGACTTCCTGGGAAAGGGGGGAAGGCCAAGGGGAAAAAAACACAAATGGCTGAAGTTTTGCCTTCTC
CGCGTGGTCAAAGAGTCATTCCACGAATAACCATAGAAATGAAAGCAGAGGCAGAAAAGAAAAATAAAAA
GAAAATTAAGAATGAAAATACTGAAGGAAGCCCTCAAGAAGATGGTGTGGAACTAGAAGGCCTAAAACAA
AGATTAGAAAAGAAACAGAAAAGAGAACCAGGTACAAAGACAAAGAAACAAACTACATTGGCATTTAAGC
CAATCAAAAAAGGAAAGAAGAGAAATCCCTGGTCTGATTCAGAATCAGATAGGAGCAGTGACGAAAGTAA
TTTTGATGTCCCTCCACGAGAAACAGAGCCACGGAGAGCAGCAACAAAAACAAAATTCACAATGGATTTG
GATTCAGATGAAGATTTCTCAGATTTTGATGAAAAAACTGATGATGAAGATTTTGTCCCATCAGATGCTA
GTCCACCTAAGACCAAAACTTCCCCAAAACTTAGTAACAAAGAACTGAAACCACAGAAAAGTGTCGTGTC
AGACCTTGAAGCTGATGATGTTAAGGGCAGTGTACCACTGTCTTCAAGCCCTCCTGCTACACATTTCCCA
GATGAAACTGAAATTACAAACCCAGTTCCTAAAAAGAATGTGACAGTGAAGAAGACAGCAGCAAAAAGTC
AGTCTTCCACCTCCACTACCGGTGCCAAAAAAAGGGCTGCCCCAAAAGGAACTAAAAGGGATCCAGCTTT
GAATTCTGGTGTCTCTCAAAAGCCTGATCCTGCCAAAACCAAGAATCGCCGCAAAAGGAAGCCATCCACT
TCTGATGATTCTGACTCTAATTTTGAGAAAATTGTTTCGAAAGCAGTCACAAGCAAGAAATCCAAGGGGG
AGAGTGATGACTTCCATATGGACTTTGACTCAGCTGTGGCTCCTCGGGCAAAATCTGTACGGGCAAAGAA
ACCTATAAAGTACCTGGAAGAGTCAGATGAAGATGATCTGTTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001067
ORF Size 4596 bp
Insert Size 6000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001067.2, NP_001058
RefSeq Size 5698
Locus ID 7153
Cytogenetics 17q21.2
Domains DNA_gyraseB, DNA_topoisoIV, HATPase_c
Protein Families Druggable Genome
Gene Summary This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.