WBSCR22 (NM_017528) Human Untagged Clone

CAT#: SC127812

WBSCR22 (untagged)-Human Williams Beuren syndrome chromosome region 22 (WBSCR22), transcript variant 2

  View "NM_017528" in other vectors (7)

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name WBSCR22 (NM_017528) Human Untagged Clone
Symbol WBSCR22
Synonyms HASJ4442; HUSSY-3; MERM1; PP3381; WBMT
Vector pCMV6-XL5
Sequence Data
>OriGene ORF within SC127812 sequence for NM_017528 edited (data generated by NextGen Sequencing)
ATGGCGTCCCGCGGCCGGCGTCCGGAGCATGGCGGACCCCCAGAGCTGTTTTATGACGAG
ACAGAAGCCCGGAAATACGTTCGCAACTCACGGATGATTGATATCCAGACCAGGATGGCT
GGGCGAGCATTGGAGCTTCTTTATCTGCCAGAGAATAAGCCCTGTTACCTGCTGGATATT
GGCTGTGGCACTGGGCTGAGTGGAAGTTATCTGTCAGATGAAGGGCACTATTGGGTGGGC
CTGGATATCAGCCCTGCCATGCTGGATGAGGCTGTGGACCGAGAGATAGAGGGAGACCTG
CTGCTGGGGGATATGGGCCAGGGCATCCCATTCAAGCCAGGCACATTTGATGGTTGCATC
AGCATTTCTGCTGTGCAGTGGCTCTGTAATGCTAACAAGAAGTCTGAAAACCCTGCCAAG
CGCCTGTACTGCTTTTTTGCTTCTCTTTTTTCTGTTCTCGTCCGGGGATCCCGAGCTGTC
CTGCAGCTGTACCCTGAGAACTCAGAGCAGTTGGAGCTGATCACAACCCAGGCCACAAAG
GCAGGCTTCTCCGGTGGCATGGTGGTAGACTACCCTAACAGTGCCAAAGCAAAGAAATTC
TACCTCTGCTTGTTTTCTGGGCCTTCGACCTTTATACCAGAGGGGCTGAGTGAAAATCAG
GATGAAGTTGAACCCAGGGAGTCTGTGTTCACCAATGAGAGGTTCCCATTAAGGATGTCG
AGGCGGGGAATGGTGAGGAAGAGTCGGGCATGGGTGCTGGAGAAGAAGGAGCGGCACAGG
CGCCAGGGCAGGGAAGTCAGACCTGACACCCAGTACACCGGCCGCAAGCGCAAGCCCCGC
TTCTAA

Clone variation with respect to NM_017528.3
>OriGene 5' read for NM_017528 unedited
GGATTTTGTATACGACTTCTATAGGGCGGCCGCGAATTCGCACGAGGTGAGAATGGTCGT
CCCGCGGCCGGCGTCCGNGACATGGCGGACCCCCAGAGCTGTTTTATGACGAGACAGAAG
CCCGGAATACGTTCGCAACTCACGGATGATTGATATCCAGACCAGGATGGCTGGGCGAGC
ATTGGAGCTTCTTTATCTGCCAGAGAATAAGCCCTGTTACCTGCTGGATATTGGCTGTGG
CACTGGGCTGAGTGGAAGTTATCTGTCAGATGAAGGGCACTATTGGGTGGGCCTGGATAT
CAGCCCTGCCATGCTGGATGAGGCTGTGGACCGAGAGATAGAGGGAGACCTGCTGCTGGG
GGATATGGGCCAGGGCATCCCATTCAAGCCAGGCACATTTGATGGTTGCATCAGCATTTC
TGCTGTGCAGTGGCTCTGTAATGCTAACAAGAAGTCTGAAAACCCTGCCAAGCGCCTGTA
CTGCTTTTTGCTTCTCTTTTTTCTGTTCTCGTCCGGGGATCCCGAGCTGTCCTGCAGCTG
TACCCTGAGAACTCAGAGCAGTTGGAGCTGATCACAACCCAGGCCACAAAGGCAGGCTTC
TCCGGTGGCATGGTGGTAGACTACCCTAACAGTGCCAAAGCAAAGAAATTCTACCTCTGC
TTGTTTTCTGGGCCTTCGACCTTTATACCAGAGGGGCTGAGTGAAAATCAGGATGAAGTT
GAACCCAGGGAGTCTGTGTTCACCAATGAGAGGTTCCCATTAAGGATGTCGAGGCGGGGA
ATGGTGAGGAAGAGTCGGGCATGGGTGCTGGAGAAAANNGAGCGCACAGCGCAGGGCAGG
GAAGTCAGACTGACACCCATACACCGCCGCAGCGCAGCCC
>OriGene 3' read for NM_017528 unedited
ATGGACCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTCCTCCCTGGAAA
AGGAAGTTTCATTATGTTGCCCAGGCAGGTCTCAAACTCCTGGCCTCAAATGATCCTCCC
ACCTCAGCCTCCCAGGTGCTGGGATTACAGGTGTGAGCCACCACGCCCGGCCCAGAGAAC
TTTTTTTTTACTGCAGAAAACATTTTTATAACTTTAGAACTTTTCTAAAATACTACTTTG
TCAGCTGAACAATATAGAAAAGTGCAGAGGCAAGTGCCTTTCCAGAACCGCGTGGTGACT
TAAAAGCGGGGCTTGCGCTTGCGGCCGGTGTACTGGGTGTCAGGTCTGACTTCCCTGCCC
TGGCGCCTGTGCCGCTCCTTCTTCTCCAGCACCCATGCCCGACTCTTCCTCACCATTCCC
CGCCTCGACATCCTTAATGGGAACCTCTCATTGGTGAACACAGACTCCCTGGGTTCAACT
TCATCCTGATTTTCACTCAGCCCCTCTGGTATAAAGGTCGAAGGCCCAGAAAACAAGCAG
AGGTAGAATTTCTTTGCTTTGGCACTGTTAGGGTAGTCTACCACCATGCCACCGGAGAAG
CCTGCCTTTGTGGCCTGGGTTGTGATCAGCTCCAACTGCTCTGAGTTCTCAGGGTACAGC
TGCAGGACAGCTCGGGATCCCCGGACGAGAACCAGAAAAAGAGAAGCAANAAGCAGTACA
GGCGCTTGGCAGGGTTTTCAGACTTCTTGNTAGCATTACAGAGCCACTGCACAGCAGAAA
TGCTGATGCAACCATCAAATGTGCCCTGGCTTGAATGGGATGCCCCTGCCCNATATCCCC
AGCAGCAGGTCTCCCTCTATCTCTCGTCCACAGCCTCATCCAGCATGGCAGGGCTGATAT
NCCAGCCACCCCATAGTGCCCTTCATCTGAACGATAACTCCATCAGCCAGTGCCACGNCA
TTCCAGCAGGTACAGGCTTATTCTTGGCAAAAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_017528
ORF Size 846 bp
Insert Size 1190
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017528.2, NP_059998
RefSeq Size 1258
RefSeq ORF 846
Locus ID 114049
Cytogenetics 7q11.23
Protein Families Druggable Genome
Protein Pathways Androgen and estrogen metabolism, Histidine metabolism, Tyrosine metabolism, Selenoamino acid metabolism
Gene Summary This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011].
Transcript Variant: This variant (2) lacks an exon in the 3' coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

Other Versions

Other products for "WBSCR22"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones