NFKB1(NFKB1) (NM_003998) Human Untagged Clone

CAT#: SC127485

NFKB1 (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), transcript variant 1

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NFKB1(NFKB1) (NM_003998) Human Untagged Clone
Symbol NFKB1
Synonyms CVID12; EBP-1; KBF1; NF-kappa-B; NF-kappaB; NF-kB1; NFkappaB; NFKB-p105; NFKB-p50; p105; p50
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003998, the custom clone sequence may differ by one or more nucleotides


ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAACAAATGTTTCATTTGGATCCTTCTTTGACTCATA
CAATATTTAATCCAGAAGTATTTCAACCACAGATGGCACTGCCAACAGCAGATGGCCCATACCTTCAAAT
ATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTA
CCTGGTGCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGACCAG
CAAAGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCACAGCCTGGTGGGAAA
ACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGACATGGTGGTCGGCTTCGCAAACCTG
GGTATACTTCATGTGACAAAGAAAAAAGTATTTGAAACACTGGAAGCACGAATGACAGAGGCGTGTATAA
GGGGCTATAATCCTGGACTCTTGGTGCACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAGGGGACCG
GCAGCTGGGAGATCGGGAAAAAGAGCTAATCCGCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTC
AGCGTGGTGCGGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTGGAAC
CCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTGAAAATTGTAAGAATGGA
CAGGACAGCTGGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTTTGTGACAAAGTTCAGAAAGATGAC
ATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGTGGAGTCTGGGAAGGATTTGGAGATTTTTCCCCCA
CAGATGTTCATAGACAATTTGCCATTGTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACC
AGCCTCTGTGTTTGTCCAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAACCAAAACCTTTCCTCTAC
TATCCTGAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCGGATA
GTTTCGGCGGTGGTAGTGGTGCTGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGCGGTGGAGGAGGGGG
CACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGATTACTTTC
CATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAACCATGGACACTGAATCTAAAAAGGACC
CTGAAGGTTGTGACAAAAGTGATGACAAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGA
GCAAGATCAGGAGCCCAGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACA
AAAGAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGGCATG
CCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTCCAGCGCCATCTCAC
TGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTG
AGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTGTACC
AGACGCCCTTGCACTTGGCAGTGATCACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAGGGCTGGGGC
CGACCTGAGCCTTCTGGACCGCTTGGGTAACTCTGTTTTGCACCTAGCTGCCAAAGAAGGACATGATAAA
GTTCTCAGTATCTTACTCAAGCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGTCTGA
ATGCCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTGGCCGCTGGGGCTGA
CGTCAATGCTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTGGCTGTGGAGCACGACAACATCTCA
TTGGCAGGCTGCCTGCTCCTGGAGGGTGATGCCCATGTGGACAGTACTACCTACGATGGAACCACACCCC
TGCATATAGCAGCTGGGAGAGGGTCCACCAGGCTGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCT
GGTGGAGAACTTTGAGCCTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGGAGTT
GTGCCTGGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGGTATTTGACATATTAAATGGGAAACCAT
ATGAGCCAGAGTTTACATCTGATGATTTACTAGCACAAGGAGACATGAAACAGCTGGCTGAAGATGTGAA
GCTGCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAACTGGGCTACTCTGGCGCAGAAATTA
GGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGTCCTGCTCCTTCCAAAACACTTATGGACAACTATG
AGGTCTCTGGGGGTACAGTCAGAGAGCTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGA
AGTGATCCAGGCAGCCTCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCGCTGCCTCTCTCGCCTGCC
TCCACAAGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACATCCT
TCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCACTGCTAACTCTCAACAAAATGCCCCA
TGATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_003998 unedited
GCCGCGAATTCGGCACCAGCCGCAGCCCTCGGCCTGCACGCAGCCACCGGCCCCGCTCCC
GGAGCCCAGCGCCGCCGAGGCCGCAGCCGCCCGGCCAGTAAGGCGGCGCCGCCGCCCGGC
CACCGCGCGCCCTGCGCTTCCCTCCGCCCGCGCTGCGGCCATGGCGCGGCGCTGACTGGC
CTGGCCCGGCCCCGCCGCGCTCCCGCTCGCCCCGACCCGCACTCGGGCCCGCCCGGGCTC
CGGCCTGCCGCCGCCTCTTCCTTCTCCAGCCGGCAGGCCCGCGCCGCTTAGGAGGGAGAG
CCCACCCGCGCCAGGAGGCCGAACGCGGACTCGCCACCCGGCTTCAGAATGGCAGAAGAT
GATCCATATTTGGGAAGGCCTGAACAAATGTTTCATTTGGATCCTTCTTTGACTCATACA
ATATTTAATCCAGAAGTATTTCAACCACAGATGGCACTGCCAACAGCAGATGGCCCATAC
CTTCAAATATTAGAGCAACCTANACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGC
CCATCCCATGGTGGACTACCTGTTGCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAG
GTCAAAATCTGCAACTATGTGGGACCAGCAAAGGTTATTGTTCAGTTGGGCACAAATGGA
AAAAATATCCACCTGCATGCCCACAGCCTGGTGGGAAAACACTGTGAGGATGGGATCTGC
ACC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003998 unedited
GCTTGGCCGCGGCCGCAATCTATATCGAGTTTTTTTTTTTTTTTTTTTGCAAATCAGAAT
AAATAACCACATTAGNAAAAAGCAATATGCCTTTTTTTTTAAAATGGCACATCAAGTGAC
TCTCATTTTAAAATATCTCTTTTCTTAACCCTTAATTTGAATGCAAAATGATGCTGTGGT
CAGAAGGAATGCCAGGTGGCGACCGTGATACCTTTAATGACAATAGGAACGTAGCAGAGG
GACAACAGCAATGACAACAGAAAGCAGCTGTGATCCAGCAGCAGCTGGCAAAGCTTATTA
AGCAACCTCATCCCCAGATGCATCCGCTCAGCCAGTGTTGTGATTGCTAGATACTATCTG
TAAGTGAACCAAACTAAAATTCATTTATGAACCAAGAAAGGAAGCCAAGTTGAAAAGGTC
TCGAGTTAAATCGAGAATGATTCAGGCGGGCCGGCTCTCTGAGCACCTTTGGATGCACTT
CTGCTTCTGTCTTGTGGACAACGCAGTGGAATTTTACGGCTTTGGCTTACACCGTGTGGG
AAATTGTCAGCACGCTAAATCTTGCCTTCTAAAGGTCCTTCCTGCCCTAATCATGGGCCA
TTCCGCTCCAAGCTACCAGCGATGCCCCACTGGCCATAAACTCCGCAAACCCCCATTCGC
GCAACGATCCTCCCCCGAGCTTTACGCCAAACCTGTCGAGTGAGACTCACCCCCCATCTT
CCGCTGCCCTCCCCCCCACCACCGCGATACAACTCAAATAGCCCCCGCCCCCCCGCTACA
TTTCCGTCAAGACACACCCCCCCGCTCGGCCGCCCGCCGCGCCCTCGTTTTTGATTGCCC
CGTCTTCCCCCCCTCCCCCTCGCATCTAACGCCCATCCCTCCCCCCGCCTCTTCGCTGCC
CGGCCCTTCCTCCCCCCCCCCCCGCCCCCCCGCGATCTTCCCTGCTCATCCTCCTCGCCC
N
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_003998
ORF Size 2910 bp
Insert Size 3800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003998.2, NP_003989
RefSeq Size 4104
Locus ID 4790
Cytogenetics 4q24
Domains RHD, DEATH, ANK, IPT
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Metabolic pathways, MAPK signaling pathway, Chemokine signaling pathway, Apoptosis, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, Cytosolic DNA-sensing pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Neurotrophin signaling pathway, Adipocytokine signaling pathway, Epithelial cell signaling in Helicobacter pylori infection, Pathways in cancer, Pancreatic cancer, Prostate cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer
Gene Summary This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). This isoform (1) may undergo proteolytic processing similar to that of isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations