SHMT1 (NM_148918) Human Untagged Clone

CAT#: SC127313

SHMT1 (untagged)-Human serine hydroxymethyltransferase 1 (soluble) (SHMT1), nuclear gene encoding mitochondrial protein, transcript variant 2

USD 196


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SHMT1 (NM_148918) Human Untagged Clone
Symbol SHMT1
Synonyms CSHMT; SHMT
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_148918, the custom clone sequence may differ by one or more nucleotides


ATGACGATGCCAGTCAACGGGGCCCACAAGGATGCTGACCTGTGGTCCTCACATGACAAGATGCTGGCAC
AACCCCTCAAAGACAGTGATGTTGAGGTTTACAACATCATTAAGAAGGAGAGTAACCGGCAGAGGGTTGG
ATTGGAGCTGATTGCCTCGGAGAATTTCGCCAGCCGAGCAGTTTTGGAGGCCCTAGGCTCTTGCTTAAAT
AACAAATACTCTGAGGGGTACCCGGGCCAGAGATACTATGGCGGGACTGAGTTTATTGATGAACTGGAGA
CCCTCTGTCAGAAGCGAGCCCTGCAGGCCTATAAGCTGGACCCACAGTGCTGGGGGGTCAACGTCCAGCC
CTACTCAGGCTCCCCTGCAAACTTTGCTGTGTACACTGCCCTGGTGGAACCCCATGGGCGCATCATGGGC
CTGGACCTTCCGGATGGGGGCCACCTGACCCATGGGTTCATGACAGACAAGAAGAAAATCTCTGCCACGT
CCATCTTCTTTGAATCTATGCCCTACAAGGTGAACCCAGATACTGGCTACATCAACTATGACCAGCTGGA
GGAGAACGCACGCCTCTTCCACCCGAAGCTGATCATCGCAGGAACCAGCTGCTACTCCCGAAACCTGGAA
TATGCCCGGCTACGGAAGATTGCAGATGAGAACGGGGCGTATCTCATGGCGGACATGGCTCACATCAGCG
GGCTGGTGGCGGCTGGCGTGGTGCCCTCCCCATTTGAACACTGCCATGTGGTGACCACCACCACTCACAA
GACCCTGCGAGGCTGCCGAGCTGGCATGATCTTCTACAGGAAAGGGGTTGCTGTGGCACTGAAGCAAGCT
ATGACTCTGGAATTTAAAGTTTATCAACACCAGGTGGTGGCCAACTGCAGGGCTCTGTCTGAGGCCCTGA
CGGAGCTGGGCTACAAAATAGTCACAGGTGGTTCTGACAACCATTTGATCCTTGTGGATCTCCGTTCCAA
AGGCACAGATGGTGGAAGGGCTGAGAAGGTGCTAGAAGCCTGTTCTATTGCCTGCAACAAGAACACCTGT
CCAGGTGACAGAAGCGCTCTGCGGCCCAGTGGACTGCGGCTGGGGACCCCAGCACTGACGTCCCGTGGAC
TTTTGGAAAAAGACTTCCAAAAAGTAGCCCACTTTATTCACAGAGGGATAGAGCTGACCCTGCAGATCCA
GAGCGACACTGGTGTCAGAGCCACCCTGAAAGAGTTCAAGGAGAGACTGGCAGGGGATAAGTACCAGGCG
GCCGTGCAGGCTCTCCGGGAGGAGGTTGAGAGCTTCGCCTCTCTCTTCCCTCTGCCTGGCCTGCCTGACT
TCTAA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_148918
ORF Size 1335 bp
Insert Size 1300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_148918.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_148918.2, NP_683718
RefSeq Size 2436
RefSeq ORF 1335
Locus ID 6470
Cytogenetics 17p11.2
Domains SHMT
Protein Pathways Glycine, serine and threonine metabolism, Cyanoamino acid metabolism, One carbon pool by folate, Methane metabolism, Metabolic pathways
Gene Summary This gene encodes the cytosolic form of serine hydroxymethyltransferase, a pyridoxal phosphate-containing enzyme that catalyzes the reversible conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. This reaction provides one-carbon units for synthesis of methionine, thymidylate, and purines in the cytoplasm. This gene is located within the Smith-Magenis syndrome region on chromosome 17. A pseudogene of this gene is located on the short arm of chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013].
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.