BMPR1A (NM_004329) Human Untagged Clone

CAT#: SC127222

BMPR1A (untagged)-Human bone morphogenetic protein receptor, type IA (BMPR1A)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BMPR1A (NM_004329) Human Untagged Clone
Symbol BMPR1A
Synonyms 10q23del; ACVRLK3; ALK3; CD292; SKR5
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_004329 edited
AATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCG
TCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCCGTC
CGCGCGCGGCGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACG
CCAAGGGCGAAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGC
TCCGCGCCGAGGGCTGGAGGATGCGTTCCCTGGGGTCCGGACTTATGAAAATATGCATCA
GTTTAATACTGTCTTGGAATTCATGAGATGGAAGCATAGGTCAAAGCTGTTTGGAGAAAA
TCAGAAGTACAGTTTTATCTAGCCACATCTTGGAGGAGTCGTAAGAAAGCAGTGGGAGTT
GAAGTCATTGTCAAGTGCTTGCGATCTTTTACAAGAAAATCTCACTGAATGATAGTCATT
TAAATTGGTGAAGTAGCAAGACCAATTATTAAAGGTGACAGTACACAGGAAACATTACAA
TTGAACAATGCCTCAGCTATACATTTACATCAGATTATTGGGAGCCTATTTGTTCATCAT
TTCTCGTGTTCAAGGACAGAATCTGGATAGTATGCTTCATGGCACTGGGATGAAATCAGA
CTCCGACCAGAAAAAGTCAGAAAATGGAGTAACCTTAGCACCAGAGGATACCTTGCCTTT
TTTAAAGTGCTATTGCTCAGGGCACTGTCCAGATGATGCTATTAATAACACATGCATAAC
TAATGGACATTGCTTTGCCATCATAGAAGAAGATGACCAGGGAGAAACCACATTAGCTTC
AGGGTGTATGAAATATGAAGGATCTGATTTTCAGTGCAAAGATTCTCCAAAAGCCCAGCT
ACGCCGGACAATAGAATGTTGTCGGACCAATTTATGTAACCAGTATTTGCAACCCACACT
GCCCCCTGTTGTCATAGGTCCGTTTTTTGATGGCAGCATTCGATGGCTGGTTTTGCTCAT
TTCTATGGCTGTCTGCATAATTGCTATGATCATCTTCTCCAGCTGCTTTTGTTACAAACA
TTATTGCAAGAGCATCTCAAGCAGACGTCGTTACAATCGTGATTTGGAACAGGATGAAGC
ATTTATTCCAGTTGGAGAATCACTAAAAGACCTTATTGACCAGTCACAAAGTTCTGGTAG
TGGGTCTGGACTACCTTTATTGGTTCAGCGAACTATTGCCAAACAGATTCAGATGGTCCG
GCAAGTTGGTAAAGGCCGATATGGAGAAGTATGGATGGGCAAATGGCGTGGCGAAAAAGT
GGCGGTGAAAGTATTCTTTACCACTGAAGAAGCCAGCTGGTTTCGAGAAACAGAAATCTA
CCAAACTGTGCTAATGCGCCATGAAAACATACTTGGTTTCATAGCGGCAGACATTAAAGG
TACAGGTTCCTGGACTCAGCTCTATTTGATTACTGATTACCATGAAAATGGATCTCTCTA
TGACTTCCTGAAATGTGCTACACTGGACACCAGAGCCCTGCTTAAATTGGCTTATTCAGC
TGCCTGTGGTCTGTGCCACCTGCACACAGAAATTTATGGCACCCAAGGAAAGCCCGCAAT
TGCTCATCGAGACCTAAAGAGCAAAAACATCCTCATCAAGAAAAATGGGAGTTGCTGCAT
TGCTGACCTGGGCCTTGCTGTTAAATTCAACAGTGACACAAATGAAGTTGATGTGCCCTT
GAATACCAGGGTGGGCACCAAACGCTACATGGCTCCCGAAGTGCTGGACGAAAGCCTGAA
CAAAAACCACTTCCAGCCCTACATCATGGCTGACATCTACAGCTTCGGCCTAATCATTTG
GGAGATGGCTCGTCGTTGTATCACAGGAGGGATCGTGGAAGAATACCAATTGCCATATTA
CAACATGGTACCGAGTGATCCGTCATACGAAGATATGCGTGAGGTTGTGTGTGTCAAACG
TTTGCGGCCAATTGTGTCTAATCGGTGGAACAGTGATGAATGTCTACGAGCAGTTTTGAA
GCTAATGTCAGAATGCTGGGCCCACAATCCAGCCTCCAGACTCACAGCATTGAGAATTAA
GAAGACGCTTGCCAAGATGGTTGAATCCCAAGATGTAAAAATCTGATGGTTAAACCATCG
GAGGAGAAACTCTAGACTGCAAGAACTGTTTTTACCCATGGCATGGGTGGAATTAGAGTG
GAATAAGGATGTTAACTTGGTTCTCAGACTCTTTCTTCACTACGTGTTCACAGGCTGCTA
ATATTAAACCTTTCAGTACTCTTATTAGGATACAAGCTGGGAACTTCTAAACACTTCATT
CTTTATATATGGACAGCTTTATTTTAAATGTGGTTTTTGATGCCTTTTTTTAAGTGGGTT
TTTATGAACTGCATCAAGACTTCAATCCTGATTAGTGTCTCCAGTCAAGCTCTGGGTACT
GAATTGCCTGTTCATAAAACGGTGCTTTCTGTGAAAGCCTTAAGAAGATAAATGAGCGCA
GCAGAGATGGAGAAATAGACTTTGCCTTTTACCTGAGACATTCAGTTCGTTTGTATTCTA
CCTTTGTAAAACAGCCTATAGATGATGATGTGTTTGGGATACTGCTTATTTTATGATAGT
TTGTCCTGTGTCCTTAGTGATGTGTGTGTGTCTCCATGCACATGCACGCCGGGATTCCTC
TGCTGCCATTTGAATTAGAAGAAAATAATTTATATGCATGCACAGGAAGATATTGGTGGC
CGGTGGTTTTGTGCTTTAAAAATGCAATATCTGACCAAGATTCGCCAATCTCATACAAGC
CATTTACTTTGCAAGTGAGATAGCTTCCCCACCAGCTTTATTTTTTAACATGAAAGCTGA
TGCCAAGGCCAAAAGAAGTTTAAAGCATCTGTAAATTTGGACTGTTTTCCTTCAACCACC
ATTTTTTTTGTGGTTATTATTTTTGTCACGGAAAGCATCCTCTCCAAAGTTGGAGCTTCT
ATTGCCATGAACCATGCTTACAAAGAAAGCACTTCTTATTGAAGTGAATTCCTGCATTTG
ATAGCAATGTAAGTGCCTATAACCATGTTCTATATTCTTTATTCTCAGTAACTTTTAAAA
GGGAAGTTATTTATATTTTGTGTATAATGTGCTTTATTTGCAAATCACCCACTCCTTTAC
AACCATACTTTATATATGTACATACATTCATACTGTAGAAACCAGCTCATGTGTACCTCA
TATCCCATCCTTAAGAGAAGAAATGTTATAAAGTAGAACTAAATATAAATTTTCAGAATT
AATGCATTCAAAGTAATATATCAAATCCAGGACTTTGTTAACTTCAGGTAAAAACTTCAT
TAGGGTAATATCATCTCAATTTTTTCAAATGAAAGGATTCTCTAATTAGAAATTTATATG
TCAGAGCTGTTATAAATTTATCAACTGTCAAATATGTTCTGGACAGCTAAATCATTTGAG
ATTTTTGGTTTTTTGATTTCTATTCCCTAACTTGTGAAGACAATGAAAAATCAGGCAGAA
ATATTTAGTATCTAGTCAGTATCTGTAGCTACACTGTATAACTGTTCTTCAATAAAATGG
TTCATATTTTATAGAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004329 unedited
TGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCCGTCCGCGCGCGG
CGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACGCCAAGGGCG
AAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGCTCCGCGCCG
AGGGCTGGAGGATGCGTTCCCTGGGGTCCGGACTTATGAAAATATGCATCAGTTTAATAC
TGTCTTGGAATTCATGAGATGGAAGCATAGGTCAAAGCTGTTTGGAGAAAATCAGAAGTA
CAGTTTTATCTAGCCACATCTTGGAGGAGTCGTAAGAAAGCAGTGGGAGTTGAAGTCATT
GTCAAGTGCTTGCGATCTTTTACAAGAAAATCTCACTGAATGATAGTCATTTAAATTGGT
GAAGTAGCAAGACCAATTATTAAAGGTGACAGTACACAGGAAACATTACAATTGAACAAT
GCCTCAGCTATACATTTACATCAGATTATTGGGAGCCTATTTGTTCATCATTTCTCGTGT
TCAAGGACAGAATCTGGATAGTATGCTTCATGGCACTGGGATGAAATCAGACTCCGACCA
GAAAAAGTCAGAAAATGGAGTAACCTTAGCACCAGAGGATACCTTGCCTTTTTTAAAGTG
CTATTGCTCAGGGCACTGTCCAGATGATGCTATTAATAACACATGCATAACTAATGGACA
TTGCTTTGCCATCATAGAAGAAGATGACCAGGGAGAAACCACATTAGCTTCAGGGTGTAT
GAAATATGAAGGATCTGATTTTCAGTGCAAAGATTCTNCANAAGCCCAGCTACGCCCGGA
CATAGAATGTTGTCGGACCAATTTATGTNACCAGTATTTGCAACCACACTNNGCCCCTGT
GTCAATAGGTCCCGTTTTTGATGCAGCATCGAATGGCTGGTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004329 unedited
GCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTTTTTCTATAAAATATGAACCATT
TTATTGAAGAACAGTTATACAGTGTAGCTACAGATACTGACTAGATACTAAATATTTCTG
CCTGATTTTTCATTGTCTTCACAAGTTAGGGAATAGAAATCAAAAAACCAAAAATCTCAA
ATGATTTAGCTGTCCAGAACATATTTGACAGTTGATAAATTTATAACAGCTCTGACATAT
AAATTTCTAATTAGAGAATCCTTTCATTTGAAAAAATTGAGATGATATTACCCTAATGAA
GTTTTTACCTGAAGTTAACAAAGTCCTGGATTTGATATATTACTTTGAATGCATTAATTC
TGAAAATTTATATTTAGTTCTACTTTATAACATTTCTTCTCTTAAGGATGGGATATGAGG
TACACATGAGCTGGTTTCTACAGTATGAATGTATGTACATATATAAAGTATGGTTGTAAA
GGAGTGGGTGATTTGCAAATAAAGCACATTATACACAAAATATAAATAACCTTCCCTTTT
AAAAGTTACTGAGAATAAAGAATATAGAACATGGTTATAGGCACTTACATTGCTATCAAA
TGCAGGAATTCACTTCAATAAGAGTGCTTTCTTTGTAGCATGTTCATGGCATAGAAGCTC
ACTTTGGAGAGATGCTTTCGTGACAAAAATATACCACAAAAAAATGTGGGTTGAGGAAAC
AGNTCAAATTACAGATGCTTTAAACTTCTTTGGGNCTTGGCATCAGCTTTCATGGTAAAA
ATAAAGCTGGTGGGGAAGCTATCTACTTGCAAGTAAATGGCTTGATGAAATTGCGAATCT
TGTCAGATTTGCATTTTTAAGCACAAACCCCGGCACCAATATTNCGTGGCAGCATATAAT
TTTTTCTCTATTCAATGCAACAAGAATCCCGGTGCTTTGCCTGGGACCCCCCCTTCCTAG
CCCCGACAAACTTCTAAATAGNCGTTCCCACCCATATCTTTAGCCGGTTCAAGGTAAATC
ACAACTGAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004329
ORF Size 1599 bp
Insert Size 3370
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004329.2, NP_004320
RefSeq Size 3631
RefSeq ORF 1599
Locus ID 657
Cytogenetics 10q23.2
Domains Activin_recp, pkinase, TyrKc, S_TKc, GS
Protein Families Protein Kinase, ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
Gene Summary The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.