RALY (NM_007367) Human Untagged Clone

CAT#: SC127088

Reviews ()
Write a review

RALY (untagged)-Human RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) (RALY), transcript variant 2


  "NM_007367" in other vectors (4)

USD 660.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name RALY (NM_007367) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol RALY
Synonyms HNRPCL2; P542
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_007367, the custom clone sequence may differ by one or more nucleotides


ATGTCCTTGAAGCTTCAGGCAAGCAATGTAACCAACAAGAATGACCCCAAGTCCATCAACTCTCGAGTCT
TCATTGGAAACCTCAACACAGCTCTGGTGAAGAAATCAGATGTGGAGACCATCTTCTCTAAGTATGGCCG
TGTGGCCGGCTGTTCTGTGCACAAGGGCTATGCCTTTGTTCAGTACTCCAATGAGCGCCATGCCCGGGCA
GCTGTGCTGGGAGAGAATGGGCGGGTGCTGGCCGGGCAGACCCTGGACATCAACATGGCTGGAGAGCCTA
AGCCTGACAGACCCAAGGGGCTAAAGAGAGCAGCATCTGCCATATACAGGCTCTTCGACTACCGGGGCCG
TCTGTCGCCCGTGCCAGTGCCCAGGGCGGTCCCTGTGAAGCGACCCCGGGTCACAGTCCCTTTGGTCCGG
CGTGTCAAAACTAACGTACCTGTCAAGCTCTTTGCCCGCTCCACAGCTGTCACCACCAGCTCAGCCAAGA
TCAAGTTAAAGAGCAGTGAGCTGCAGGCCATCAAGACGGAGCTGACACAGATCAAGTCCAATATCGATGC
CCTGCTGAGCCGCTTGGAGCAGATCGCTGCGGAGCAAAAGGCCAATCCAGATGGCAAGAAGAAGGGTGAT
GGAGGTGGCGCCGGCGGCGGCGGCGGTGGTGGTGGCAGCGGTGGCGGTGGCAGTGGTGGTGGCGGTGGCG
GTGGCAGCAGCCGGCCACCAGCCCCCCAAGAGAACACAACTTCTGAGGCAGGCCTGCCCCAGGGGGAAGC
ACGGACCCGAGACGACGGCGATGAGGAAGGGCTCCTGACACACAGCGAGGAAGAGCTGGAACACAGCCAG
GACACAGACGCGGATGATGGGGCCTTGCAGTAA


>OriGene 5' read for NM_007367 unedited
GGATTTTGTATACGACTCACTATAGGGCGGCCGCGAATTCGCACGAGGGGCAGTACCGCC
TCCTTCCCAGCCGCGCGGCTTCCTCCAGACCTCTCGGCGCGGGTGAGCCCTATTCCCAGA
GGCAGGTGGTGCTGACCCTGTAACCCAAAGGAGGAAACAGCTGGCTAAGCTCATCATTGT
TACTGGTGGGCACCATGTCCTTGAAGCTTCAGGCAAGCAATGTAACCAACAAGAATGACC
CCAAGTCCATCAACTCTCGAGTCTTCATTGGAAACCTCAACACAGCTCTGGTGAAGAAAT
CAGATGTGGAGACCATCTTCTCTAAGTATGGCCGTGTGGCCGGCTGTTCTGTGCACAAGG
GCTATGCCTTTGTTCAGTACTCCAATGAGCGCCATGCCCGGGCAGCTGTGCTGGGAGAGA
ATGGGCGGGTGCTGGCCGGGCAGACCCTGGACATCAACATGGCTGGAGAGCCTAAGCCTG
ACAGACCCAAGGGGCTAAAGAGAGCAGCATCTGCCATATACAGTGGCTACATCTTTGACT
ATGATTACTACCGGGACGACTTCTACGACAGGCTCTTCGACTACCGGGGCCGTCTGTCGC
CCGTGCCAGTGCCCAGGGCGGTCCCTGTGAAGCGACCCCGGGTCACAGTCCCTTTGGTCC
GGCGTGTCAAAACTAACGTACCTGTCAAGCTCTTTGCCCGCTCCACAGCTGTCACCACCA
GCTCAGCCAAGATCAAGNTAAAGAATAGTGAGCTGCAGGCCATCAAGACGGAGCTGACAC
AGATCAAGTCCAATATCGATGCCCTGCTGAGCCGCTTGGAGCAGATCGCTGCNGAGCAAA
AGGCCATCCAGATGGCAGAAGAAGGTGATNNGAGTGCGCC
>OriGene 3' read for NM_007367 unedited
CATTTGNACCCGGCCGCATTCTANATCGAGTTTTTTTTTTTTTTTTTTGGGATCCAATCT
CTTTATTGTCAGGGTCCCCTCCCTGTGGCCCCCCGCCAAACCTATAGAAAAAACCCAAGC
CTGGGAGTGTCCTGGGGAGGGGAGGTAGTATGGGGAAACCCCTGTGCTCTACCCTCTGGC
CTGGGCAGTGCAGACAGGGAGGGCTCATGGGGAAGGAGTAGGCCAGTAACTCCACCTGCA
GAGGACATGGCACTGGCTGGGATGCGTTGGGGGAGGAGGCGCCTGCTGCCAGCTTTCCTC
TGGTACCCGCTGGGGGGTGGCATCCAGGGTTGGGTGCCCGGCTTGAGGCCTGGGGCAGCG
ATGCCCTTCACCTGCTGGTGGCCATTGCTCCTGTCAGGCTGCTTACTGCAAGGCCCCATC
ATCCGCGTCTGTGTCCTGGCTGTGTTCCAGCTCTTCCTCGCTGTGTGTCAGGAGCCCTTC
CTCATCGCCGTCGTCTCGGGTCCGTGCTTCCCCCTGGGGCAGGCCTGCCTCAGAAGTTGT
GTTCTCTTGGGGGGCTGGGTGGCCGGCTGCTGNCACCGCCACCGGCACCACCACTGGCAC
CGNCACCGTTGNCACCACCACCGNCGNCGCCGCCGTTGGCGCCACCTTCATTACCCTTCT
TCTTGGCATCTGGATTGGCCTTTTGCTCCGCAGCGATCTTGTTCCACCGGCTCAACAGGG
CATTGATATTGGACTTGATCTGTGTCAGCTCCGGCTTGATGGGCTGCAACTCACTGCTCT
TTACTTGATCTTGCTTGACCTGTGGGGGACAGCTGTGGAGCGGCCAAGAACTTGACAGGT
ACCTTTATTTTGACACCCCGGACCAGGGACTGTGACCCGGGGTCCTTTACAGGACCCGCC
CTGGCACTGGAACGGCGAAAAACGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007367
ORF Size 873 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007367.2, NP_031393.2
RefSeq Size 1541
RefSeq ORF 873
Locus ID 22913
Cytogenetics 20q11.22
Domains RRM
Gene Summary This gene encodes a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) gene family. This protein may play a role in pre-mRNA splicing and in embryonic development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. This isoform is also known as short isoform.

Other Versions

Other products for "RALY"
Frequently bought together (2)
Rabbit polyclonal anti-RALY antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools