Protein kinase Y linked (PRKY) (NM_002760) Human Untagged Clone
CAT#: SC126856
PRKY (untagged)-Human protein kinase, Y-linked (PRKY)
"NM_002760" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Protein kinase Y linked |
Synonyms | OTTHUMP00000033227; protein kinase, Y-linked |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002760 edited
GGACCTGAGTGCCTCCCCATGGAGGCGCCCGGGCCGGCCCAGGCGGCCGCGGCGGAGAGC AACTCCCGAGAGGTGACGGAGGATGCCGCCGACTGGGCGCCCGCGCTCTGCCCCAGCCCC GAGGCGCGGTCGCCGGAGGCGCCTGCCTACCGCCTGCAGGACTGCGACGCGCTGGTCACC ATGGGCACTGGGACGTTCGGGCGGGTGCACCTGGTGAAGGAGAAGACAGCCAAGCATTTC TTCGCCCTCAAGGTGATGAGCATTCCCGACGTCATCCGCCGGAAGCAGGAGCAGCACGTG CACAATGAGAAGTCTGTCCTGAAGGAAGTCAGCCACCCGTTCCTCATCAGGCTGTTCTGG ACGTGGCATGAGGAGCGCTTCCTCTACATGCTCATGGAGTATGTGCCGGGTGGCGAGCTC TTCAGCTACCTGCGCAACCGGGGGCACTTCTCCAGCACCACGGGGCTCTTCTACTCTGCG GAGATCATCTGTGCCATTGAGTACCTGCACTCCAAGGAGATCGTCTACAGGGATTTGAAG CCGGAGAACATCCTGCTGGATAGGGATGGTCACATCAAGCTCACGGACTTTGGGTTTGCC AAGAAGCTGGTAGACAGGACTTGGACCCTCTGTGGAACACCCGAGTACCTAGCCCCCGAA GTCATTCAGAGCAAGGGCCACGGAAGGGCCGTGGACTGGTGGGCCCTCGGCATCCTGATA TTCGAGATGCTTTCGGGGTTTCCTCCATTTTTTGATGACAACCCGTTTGGCATTTATCAG AAAATTCTTGCAGGCAAACTATATTTCCCCAGACATTTGGATTTCCATGTAAAAACGGGG CGAATGATGTGAAACACCATCGGTGGTTCCGCTCCGTGGACTGGAAAGCTGTTCC |
Restriction Sites | Please inquire |
ACCN | NM_002760 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002760.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002760.2, NP_002751.1 |
RefSeq Size | 7228 bp |
RefSeq ORF | 834 bp |
Locus ID | 5616 |
Cytogenetics | Yp11.2 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | This gene is similar to the protein kinase, X-linked gene in the pseudoautosomal region of the X chromosome. The gene is classified as a transcribed pseudogene because it has lost a coding exon that results in all transcripts being candidates for nonsense-mediated decay (NMD) and unlikely to express a protein. Abnormal recombination between this gene and a related gene on chromosome X is a frequent cause of XX males and XY females. [provided by RefSeq, Jul 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210438 | PRKY (Myc-DDK-tagged)-Human protein kinase, Y-linked (PRKY) |
USD 300.00 |
|
RC210438L1 | Lenti ORF clone of Human protein kinase, Y-linked (PRKY), Myc-DDK-tagged |
USD 600.00 |
|
RC210438L2 | Lenti ORF clone of Human protein kinase, Y-linked (PRKY), mGFP tagged |
USD 600.00 |
|
RC210438L3 | Lenti ORF clone of Human protein kinase, Y-linked (PRKY), Myc-DDK-tagged |
USD 600.00 |
|
RC210438L4 | Lenti ORF clone of Human protein kinase, Y-linked (PRKY), mGFP tagged |
USD 600.00 |
|
RG210438 | PRKY (tGFP-tagged) - Human protein kinase, Y-linked (PRKY) |
USD 500.00 |
|
SC323404 | PRKY (untagged)-Kinase deficient mutant (K78M) of Human protein kinase, Y-linked (PRKY) |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review