EGLN1(EGLN1) (NM_022051) Human Untagged Clone

CAT#: SC126735

EGLN1 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human egl nine homolog 1 (C. elegans) (EGLN1)

USD 680.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EGLN1(EGLN1) (NM_022051) Human Untagged Clone
Symbol EGLN1
Synonyms C1orf12; ECYT3; HALAH; HIF-PH2; HIFPH2; HPH-2; HPH2; PHD2; SM20; ZMYND6
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_022051, the custom clone sequence may differ by one or more nucleotides


ATGGCCAATGACAGCGGCGGGCCCGGCGGGCCGAGCCCGAGCGAGCGAGACCGGCAGTACTGCGAGCTGT
GCGGGAAGATGGAGAACCTGCTGCGCTGCAGCCGCTGCCGCAGCTCCTTCTACTGCTGCAAGGAGCACCA
GCGTCAGGACTGGAAGAAGCACAAGCTCGTGTGCCAGGGCAGCGAGGGCGCCCTCGGCCACGGAGTGGGC
CCACACCAGCATTCCGGCCCCGCGCCGCCGGCTGCAGTGCCGCCGCCCAGGGCCGGGGCCCGGGAGCCCA
GGAAGGCAGCGGCGCGCCGGGACAACGCCTCCGGGGACGCGGCCAAGGGAAAAGTAAAGGCCAAGCCCCC
GGCCGACCCAGCGGCGGCCGCGTCGCCGTGTCGTGCGGCCGCCGGCGGCCAGGGCTCGGCGGTGGCTGCC
GAAGCCGAGCCCGGCAAGGAGGAGCCGCCGGCCCGCTCATCGCTGTTCCAGGAGAAGGCGAACCTGTACC
CCCCAAGCAACACGCCCGGGGATGCGCTGAGCCCCGGCGGCGGCCTGCGGCCCAACGGGCAGACGAAGCC
CCTGCCGGCGCTGAAGCTGGCGCTCGAGTACATCGTGCCGTGCATGAACAAGCACGGCATCTGTGTGGTG
GACGACTTCCTCGGCAAGGAGACCGGACAGCAGATCGGCGACGAGGTGCGCGCCCTGCACGACACCGGGA
AGTTCACGGACGGGCAGCTGGTCAGCCAGAAGAGTGACTCGTCCAAGGACATCCGAGGCGATAAGATCAC
CTGGATCGAGGGCAAGGAGCCCGGCTGCGAAACCATTGGGCTGCTCATGAGCAGCATGGACGACCTGATA
CGCCACTGTAACGGGAAGCTGGGCAGCTACAAAATCAATGGCCGGACGAAAGCCATGGTTGCTTGTTATC
CGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGACATGTAT
ATATTATCTTAATAAAGACTGGGATGCCAAGGTAAGTGGAGGTATACTTCGAATTTTTCCAGAAGGCAAA
GCCCAGTTTGCTGACATTGAACCCAAATTTGATAGACTGCTGTTTTTCTGGTCTGACCGTCGCAACCCTC
ATGAAGTACAACCAGCATATGCTACAAGGTACGCAATAACTGTTTGGTATTTTGATGCAGATGAGAGAGC
ACGAGCTAAAGTAAAATATCTAACAGGTGAAAAAGGTGTGAGGGTTGAACTCAATAAACCTTCAGATTCG
GTCGGTAAAGACGTCTTCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_022051 unedited
ACCAGTCGCAATTTGTATACGATCATATAGGCGGCCGCGCCCTGCAGCGAGGGTAGCGGG
TGCATGGCGCAGTAACGGCCCCTATCTCTCTCCCCGCTCCCCAGCCTCGGGCGAGGCCGT
CCGGCCGCTACCCCTCCTGCTCGGCCGCCGCAGTCGCCGTCGCCGCCGCCGCCGCCGCCA
TGGCCAATGACAGCGGCGGGCCCGGCGGGCCGAGCCCGAGCGAGCGAGACCGGCAGTACT
GCGAGCTGTGCGGGAAGATGGAGAACCTGCTGCGCTGCAGCCGCTGCCGCAGCTCCTTCT
ACTGCTGCAAGGAGCACCAGCGTCAGGACTGGAAGAAGCACAAGCTCGTGTGCCAGGGCA
GCGAGGGCGCCCTCGGCCACGGAGTGGGCCCACACCAGCATTCCGGCCCCGCGCCGCCGG
CTGCAGTGCCGCCGCCCAGGGCCGGGGCCCGGGAGCCCAGGAAGGCAGCGGCGCGCCGGG
ACAACGCCTCCGGGGACGCGGCCAAGGGAAAAGTAAAGGCCAAGCCCCCGGCCGACCCAG
CGGCGGCCGCGTCGCCGTCTCGTGCGGCCGCCGGCGGCCAGGGCTCTGGCGGTGGCTGCC
GAAGCCGAGCCCGGCANGGAGGAGCCGCCGGCCCGCTCATCGCTGATCCAGGACGAGGCG
AACCTGTACCCCCCAAGCACACGCCTGGNGATGCGCTGAGCCCTGGCGGCGCCTGCGGCC
CACGGGCAGACGAAGCCCCTGCGGCGCTGAAGCTGGCGCTCGGTACATCGTGCTGTGCAT
GAACAACACGCATCTGGGGTGTTGGACGACTTCCTCGGCAGGAGACTGACAGAGATCTGC
CACCAGGTGCCCGCCTGACACACCGGGAAGTCAGGACGGCCACTTGTCCCCACAAAGGAC
TTTTCCAGGACATCAGGGCAATAACACCTGTACTAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_022051 unedited
NGGGCCGTCTTGNACCCGGCCGCATNTNANGATCGAGTTTTTTTTTTTTTTTTTTAAGAG
TCTTTTAGGGCAAAATTTAATAGTATGAACAGGTTTACAAAAATAGATTGATGTTATTTT
GAGGAATAATACTGTAATTTTTTCTCAATTCAGTTTAGATAAATTGTACCTAATATAGAA
AAATTATCCCAAATTCAAACTTGATATAAAAAAGGGAGAGATGAAATGAACTCAGCTAGA
TAACAGATCTGGCAAAATATAAGAATGAAAAAAATTCTACACAGGGCACTTATTTCATAT
CCAGATGTAAAAACCATTTTCAATTAGTAGCTTATCTTCCTCCTGTAAGCAATCACAGAT
TTGAAGTTGATCATGCAGTACAAAGTCACAGCAGTCAAAATCTTCTGTTTGATGCAACAC
AAAAAGTTGTTTCTGTTTCCTTATTAAAATGCGAACTGGTTGTCTATTTTTCTTTATCCC
ATTTATTCGTATTCACAAGTTAACAAATAGTTAACAATATTGTAGGTGAAGTGGGGTATT
GCTGGATCAAAGGCTCTAGAAGACGTCTTTACCGACCGAATCTGAAGGTTTATTGAGTTC
AACCCTCACACCTTTTTCACCTTGTAGCATATGCTGGTTGTACTTCATGAGGGTTGCGAC
GGTCAGACCAGAAAAACAGCAGTCTATCAAATTTGGGTTCAATGTCAGCAAACTGGGCTT
TGCCTTCTGGAAAAATTCGAGTATACCTNCACTTACCTTGGCATNCCAGTCTTTATTAAG
ATATATATACATGTCACACATCTTCCATCTNCATTTGGGATATCAACATGACGTACATAA
CCCCGTCCATTGCCCGGNANNACAGCACCATGGCTTTCGTNCGGCCATTGATTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_022051
ORF Size 1281 bp
Insert Size 1800
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_022051.1, NP_071334
RefSeq Size 5163
Locus ID 54583
Cytogenetics 1q42.2
Domains zf-MYND, 2OG-FeII_Oxy, P4Hc
Protein Pathways Pathways in cancer, Renal cell carcinoma
Gene Summary The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). [provided by RefSeq, Nov 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.