MT ATP6(MTATP6) (NM_173702) Human Untagged Clone

CAT#: SC126708

MTATP6 (untagged)-Human ATP synthase 6 (MTATP6)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MT ATP6(MTATP6) (NM_173702) Human Untagged Clone
Symbol MTATP6
Synonyms ATP6
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_173702, the custom clone sequence may differ by one or more nucleotides


ATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCA
TTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACA
ATGACTAATCAAACTAACCTCAAAACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTT
ATACTAGTATCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACAC
CAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTT
TCGCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATA
CTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACA
TTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCC
CTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAA
GCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_173702 unedited
TTTGTATACGACTCATATAGGCGGCNCGCGAATCGGCACGAGGGTAAGAAGTGGGCTAGG
GCATTTTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGAAACC
ATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCA
GGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTT
CCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTC
GCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACA
TAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAG
GGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCA
TAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGGCGCG
ATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTC
GATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAG
CCTTTTACCACTCCAGCCTAGCCCCCTACCCCCCATTAGGAAGGCACTGGGCCCCCAACA
GCATCACCCCGCTAAATCCCCTAGAAGTNCCACTCCTAACACATNCGTATTACTCGCTNC
AGGAGTATCAATCACCTGAGCTCACCATAGTCAAATAGAAACAACCGAACCAAATATTCA
AGCACTGCTATTACATTTACTGGGTCTCTATTTACCTNCTACAGCTNAGAGTACTTGAGT
TTTCTTCACATTTCGACGGATNACGGTCACATTTTTGAGNCCAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_173702
ORF Size 843 bp
Insert Size 1100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_173702.1, NP_776050
RefSeq Size 843
RefSeq ORF 843
Locus ID 4508
Cytogenetics -
Protein Families Transmembrane
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Key component of the proton channel; it may play a direct role in the translocation of protons across the membrane. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.