SNF2H (SMARCA5) (NM_003601) Human Untagged Clone

CAT#: SC126702

SMARCA5 (untagged)-Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (SMARCA5)


  "NM_003601" in other vectors (6)

Reconstitution Protocol

USD 917.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


SMARCA5 Rabbit monoclonal Antibody
    • 100 ul

USD 380.00

Other products for "SNF2H"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SNF2H
Synonyms hISWI; hSNF2H; ISWI; SNF2H; WCRF135
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_003601, the custom clone sequence may differ by one or more nucleotides


ATGTCGTCCGCGGCCGAGCCTCCGCCACCCCCGCCTCCCGAGAGCGCGCCTTCCAAGCCCGCAGCCTCGA
TCGCCAGCGGCGGGAGCAACAGCAGCAACAAAGGCGGCCCCGAAGGCGTCGCGGCGCAGGCGGTTGCGTC
TGCGGCCAGCGCTGGTCCCGCAGACGCCGAGATGGAGGAAATATTTGATGATGCGTCACCTGGAAAGCAA
AAGGAAATCCAAGAACCAGATCCTACCTATGAAGAAAAAATGCAAACTGACCGGGCAAATAGATTCGAGT
ATTTATTAAAGCAGACAGAACTTTTTGCACATTTCATTCAACCTGCTGCTCAGAAGACTCCAACTTCACC
TTTGAAGATGAAACCAGGGCGCCCACGAATAAAAAAAGATGAGAAGCAGAACTTACTATCCGTTGGCGAT
TACCGACACCGTAGAACAGAGCAAGAGGAGGATGAAGAGCTATTAACAGAAAGCTCCAAAGCAACCAATG
TTTGCACTCGATTTGAAGACTCTCCATCGTATGTAAAATGGGGTAAACTGAGAGATTATCAGGTCCGAGG
ATTAAACTGGCTCATTTCTTTGTATGAGAATGGCATCAATGGTATCCTTGCAGATGAAATGGGCCTAGGA
AAGACTCTTCAAACAATTTCTCTTCTTGGGTACATGAAACATTATAGAAACATTCCTGGGCCTCATATGG
TTTTGGTTCCTAAGTCTACATTACACAACTGGATGAGTGAATTCAAGAGATGGGTACCAACACTTAGATC
TGTTTGTTTGATAGGAGATAAAGAACAAAGAGCTGCTTTTGTCAGAGACGTTTTATTACCGGGAGAATGG
GATGTATGTGTAACATCTTATGAAATGCTTATTAAAGAGAAGTCTGTGTTCAAAAAATTTAATTGGAGAT
ACTTAGTAATAGATGAAGCTCACAGGATCAAAAATGAAAAATCTAAGTTGTCAGAAATAGTGAGGGAATT
CAAGACTACAAATAGACTATTATTAACTGGAACACCTCTTCAGAACAACTTGCATGAGCTGTGGTCACTT
CTTAACTTTCTGTTGCCAGATGTGTTTAATTCAGCAGATGACTTTGATTCCTGGTTTGATACAAACAACT
GCCTTGGGGATCAAAAACTAGTTGAGAGGCTTCATATGGTTTTGCGTCCATTCCTCCTTCGTCGAATTAA
GGCTGATGTTGAAAAGAGTTTGCCTCCAAAGAAGGAAGTAAAAATCTATGTGGGCCTCAGCAAAATGCAA
AGGGAATGGTATACTCGGATATTAATGAAGGATATAGATATACTCAACTCAGCAGGCAAGATGGACAAAA
TGAGGTTATTGAACATCCTAATGCAGTTGAGAAAATGTTGTAATCATCCATATCTCTTTGATGGAGCAGA
ACCTGGTCCACCTTATACAACAGATATGCATCTAGTAACCAACAGTGGCAAAATGGTGGTTTTAGACAAG
CTGCTCCCTAAGTTAAAAGAACAAGGTTCACGAGTACTAATCTTCAGTCAAATGACAAGGGTATTGGACA
TTTTGGAAGATTATTGCATGTGGAGAAATTATGAGTACTGCAGGTTGGATGGTCAGACACCCCATGATGA
GAGACAAGACTCCATCAATGCATACAATGAACCAAACAGCACAAAGTTTGTTTTCATGTTAAGCACGCGT
GCTGGTGGTCTTGGCATCAATCTTGCGACTGCTGATGTAGTAATTTTGTATGATTCTGATTGGAATCCCC
AAGTAGATCTTCAGGCTATGGACCGAGCACATAGAATTGGGCAGACTAAGACAGTCAGAGTGTTCCGCTT
TATAACTGATAACACTGTAGAAGAAAGAATAGTAGAACGTGCTGAGATGAAACTCAGACTGGATTCAATA
GTCATTCAACAAGGGAGGCTTGTGGATCAGAATCTGAACAAAATTGGGAAAGATGAAATGCTTCAAATGA
TTAGACATGGAGCAACACATGTGTTTGCTTCAAAGGAAAGTGAGATCACTGATGAAGATATCGATGGTAT
TTTGGAAAGAGGTGCAAAGAAGACTGCAGAGATGAATGAAAAGCTCTCCAAGATGGGCGAAAGTTCACTT
AGAAACTTTACAATGGATACAGAGTCAAGTGTTTATAACTTCGAAGGAGAAGACTATAGAGAAAAACAAA
AGATTGCATTCACAGAGTGGATTGAACCACCTAAACGAGAAAGAAAAGCCAACTATGCCGTTGATGCATA
TTTCAGGGAAGCTCTTCGTGTTAGTGAACCTAAAGCACCCAAGGCTCCTCGACCTCCAAAACAACCCAAT
GTTCAGGATTTCCAGTTCTTTCCTCCACGTTTATTTGAATTACTGGAAAAAGAAATTCTGTTTTACAGAA
AAACTATTGGGTACAAGGTACCTCGAAATCCTGAGCTGCCTAACGCAGCACAGGCACAAAAAGAAGAACA
GCTTAAAATTGATGAAGCTGAATCCCTTAATGATGAAGAGTTAGAGGAAAAAGAGAAGCTTCTAACACAG
GGATTTACCAATTGGAATAAGAGAGATTTTAACCAGTTTATCAAAGCTAATGAGAAGTGGGGTCGTGATG
ATATTGAAAATATAGCAAGAGAAGTAGAAGGCAAAACTCCAGAAGAAGTCATTGAATATTCAGCTGTGTT
TTGGGAAAGGTGCAACGAGCTCCAGGACATAGAGAAGATTATGGCTCAGATTGAAAGGGGAGAGGCGAGA
ATTCAAAGAAGAATAAGCATCAAGAAAGCACTTGACACAAAGATTGGACGGTACAAAGCACCTTTTCATC
AGCTGAGAATATCATATGGTACTAACAAAGGAAAAAACTATACTGAAGAAGAAGATCGTTTTCTGATTTG
TATGCTTCACAAACTTGGATTTGACAAAGAAAATGTTTATGATGAATTGCGACAGTGTATTCGCAACTCT
CCTCAGTTCAGATTTGACTGGTTTCTTAAGTCCAGAACTGCAATGGAGCTCCAGAGGAGATGTAATACCT
TAATTACTTTGATTGAAAGAGAAAACATGGAACTAGAAGAAAAGGAGAAGGCAGAGAAAAAGAAACGAGG
ACCAAAGCCTTCAACACAGAAACGTAAAATGGATGGCGCACCTGATGGTCGAGGAAGAAAAAAGAAGCTG
AAACTATGA


>OriGene 5' read for NM_003601 unedited
GCACATTTTGGAATACGACTCACTATAGGGCGGCCGCGGAATTCGCACGAGGGCCCCGCG
GAAGACAGAACGTTTGGGAGTGTGCAGCTCCTGGGCCCGGCTCAAGCCCGTCGCGGAGGC
GCGGCGCAGGGGAGCGCTCGGGTGGGAGTCTCGCTCCTCCACCAGTTTATTGCGACGTAG
CATCCAGGCCTAGGCCTCCCCGTCCATCCCCGCCGGACTCGGGCCTCTGGCAGCAGCGGG
TGACGCAGACGGAACATCATGTCGTCCGCGGCCGAGCCTCCGCCACCCCCGCCTCCCGAG
AGCGCGCCTTCCAAGCCCGCAGCCTCGATCGCCAGCGGCGGGAGCAACAGCAGCAACAAA
GGCGGCCCCGAATGCGTCTCGGCGCAGGCGGATGCGTCTGCGGCCAGCGCTGGTCCCGCA
GACGCCGGGATGGAGGAAATATTTGATGATGCGTCACCTGGAAAGCAAAAGGAAATCCAA
GAACCAGATCCTACCTATGAAGAAAAAATGCAAACTGACCGGGCAAATAGATTCGAGTAT
TTATTAAAGCAGACAGAACTTTTTGCACATTTCATTCACCCTGCTGCTCAGAAGACTCCA
ACTTCACCTTTGAAGATGAAACCAGAGCGCCCACGAATAATAAGAGATGAGAAGCAGAAC
TTACTATCCGTTGGCGATTACCGACACCGTTAGACAGAGCATGAGAGGATGAACAGCTGT
TAACAGAAAGCTCCAAAGCAACCAATGTTTGCACTCGCATTTGAGACTCTCCATCGTNTG
TGAAATGGGGTAAACTGANAGATTATCAGGTCCGAGGATTAAACTGCCTCATTTCCTTCG
CTGAGAATGGCATCAATGCTATCCTTGCGGAAGAATAGGGCCTATGAAGACTCTTCAACC
ATTTCTCTCTTGGGTCCTGAACATTATGGAACTTTCTGGCCTATAAGGGTTTGTGCTAGC
GTACATAACACTGG
>OriGene 3' read for NM_003601 unedited
TATGAACCCGCGGCCGCATTCTAGGATCGAGTTTTTTTTTTTTTTTTTTTAATAAATGAA
GCCTATTTTATTACTTCAAGTGTTAATGATAAAAAAATTCAGCACAGCTGTTGCATTTAA
AAAAGTGAAACTACATACTATGTTTCTAGCTCAGTAAACAGATGAACCTGATGTCTTTAA
ATGACATAACAATTGAGCATTGTACAGTACATCTTATGAAGACCCGTAAATTAAAGAACT
ACTGGTTTAAAGTTAGTGATTATGAAACAAAAACATATTCATAGTTTCAGCTTCTTTTTT
CTTCCTCGACCATCAGGTGCGCCATCCATTTTACGTTTCTGTGTTGAAGGCTTTGGTCCT
CGTTTCTTTTTCTCTGCCTTCTCCTTTTCTTCTAGTTCCATGTTTTCTCTTTCAATCAAA
GTAATTAAGGTATTACATCTCCTCTGGAGCTCCATTGCAGTTCTGGACTTAAGAAACCAG
TCAAATCTGAACTGAGGAGAGTTGCGAATACACTGTCGCAATTCATCATAAACATTTTCT
TTGTCAAATCCAAGTTTGTGAAGCATACAAATCAGAAAACGATCTTCTTCTTCAGTATAG
TTTTTTCCTTTGTTAGTACCATATGATATTCTCAGCTGATGAAAAGGTGCTTTGTACCGT
CCAATCTTTGTGTCAAGTGCTTTCTTGATGCTTATTCTTCTTTGAATTCTCGCCTCTCCC
CTTTCAATCTGAGCCATAATCTTCTCTATGTCCTGGAGCTCGTTGCACCTTTCCCAAACA
CAGCTGAATATTCATGACTTCTTCTGGAGTTNTGCCTTCTACTTCTCTTGCTATATTTTC
AATATCATCACGACCCCACTTCTCATTAGCTTTGATAAACTGGGTAAAATCTCTCTATCC
NATTGGGTAATCCNTGTGTTAGAAGCTCTCTTTTTCCTCTACTCTCATCATAAGGAATCA
GCTTCTCATTTTAAGCTGTCTCTTTGGGCCTGGCTGCGTT
Restriction Sites NotI-NotI     
ACCN NM_003601
Insert Size 3800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003601.2, NP_003592.2
RefSeq Size 3866 bp
RefSeq ORF 3159 bp
Locus ID 8467
UniProt ID O60264
Cytogenetics 4q31.21
Domains SNF2_N, myb_DNA-binding, DEAD, helicase_C
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.