EP2(PTGER2) (NM_000956) Human Untagged Clone

CAT#: SC126558

PTGER2 (untagged)-Human prostaglandin E receptor 2 (subtype EP2), 53kDa (PTGER2)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EP2(PTGER2) (NM_000956) Human Untagged Clone
Symbol PTGER2
Synonyms EP2; EP2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000956 edited
ATGGGCAATGCCTCCAATGACTCCCAGTCTGAGGACTGCGAGACGCGACAGTGGCTTCCC
CCAGGCGAAAGCCCAGCCATCAGCTCCGTCATGTTCTCGGCCGGGGTGCTGGGGAACCTC
ATAGCACTGGCGCTGCTGGCGCGCCGCTGGCGGGGGGACGTGGGGTGCAGCGCCGGCCGC
AGGAGCTCCCTCTCCTTGTTCCACGTGCTGGTGACCGAGCTGGTGTTCACCGACCTGCTC
GGGACCTGCCTCATCAGCCCAGTGGTACTGGCTTCGTACGCGCGGAACCAGACCCTGGTG
GCACTGGCGCCCGAGAGCCGCGCGTGCACCTACTTCGCTTTCGCCATGACCTTCTTCAGC
CTGGCCACGATGCTCATGCTCTTCGCCATGGCCCTGGAGCGCTACCTCTCGATCGGGCAC
CCCTACTTCTACCAGCGCCGCGTCTCGCGCTCCGGGGGCCTGGCCGTGCTGCCTGTCATC
TATGCAGTCTCCCTGCTCTTCTGCTCGCTGCCGCTGCTGGACTATGGGCAGTACGTCCAG
TACTGCCCCGGGACCTGGTGCTTCATCCGGCACGGGCGGACCGCTTACCTGCAGCTGTAC
GCCACCCTGCTGCTGCTTCTCATTGTCTCGGTGCTCGCCTGCAACTTCAGTGTCATTCTC
AACCTCATCCGCATGCACCGCCGAAGCCGGAGAAGCCGCTGCGGACCTTCCCTGGGCAGT
GGCCGGGGCGGCCCCGGGGCCCGCAGGAGAGGGGAAAGGGTGTCCATGGCGGAGGAGACG
GACCACCTCATTCTCCTGGCTATCATGACCATCACCTTCGCCGTCTGCTCCTTGCCTTTC
ACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCT
CTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCT
CCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGAT
GCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000956
ORF Size 1077 bp
Insert Size 1100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000956.2, NP_000947
RefSeq Size 2395
RefSeq ORF 1077
Locus ID 5732
Cytogenetics 14q22.1
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.