Tubulin(TUBA1B) (BC021564) Human Untagged Clone

CAT#: SC126285

TUBA1B (untagged)-Human tubulin, alpha, ubiquitous, mRNA (cDNA clone MGC:31891 IMAGE:4579604), complete cds

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tubulin(TUBA1B) (BC021564) Human Untagged Clone
Symbol TUBA1B
Synonyms K-ALPHA-1; alpha tubulin; tubulin, alpha, ubiquitous; tubulin, alpha 1b
Vector pCMV6-XL5
Sequence Data
>OriGene sequence for BC021564 edited
CTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTGCTCCTGTCGCCTTC
GCCTCCTAATCCCTAGCCACTATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGT
GTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGAT
GGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGACTCCTTCAACACCTTCTTC
AGTGAGACGGGCGCTGGCAAGCACGTGCCCCGGGCTGTGTTTGTAGACTTGGAACCCACA
GTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATC
ACAGGCAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACTAACCTTAACCGC
CTTATTAGCCAGATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAAT
GTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCTCTG
GCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA
GAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCAT
GGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAAT
GCTGCCATTGCCACCATCAAAACCAAGCGCAGCATCCAGTTTGTGGATTGGTGCCCCACT
GGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCC
AAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCT
CGCCTGGACCACAAGTTTGACCTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTG
GGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGCCCTTGAG
AAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAG
GAATACTAATTATCCATTCCTTTTGGCCCTGCAGCATGTCATGCTCCCAGAATTTCAGCT
TCAGCTTAACTGACAGACGTTAAAGCTTTCTGGTTAGATTGTTTTCACTTGGTGATCATG
TCTTTTCCATGTGTACCTGTAATATTTTTCCATCATATCTCAAAGTAAAGTCATTAACAT
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for BC021564 unedited
NGCCGTCAGATTTTGTATACGACTCACTATAGGCGGACCGCGAATCGGCACGAGGCTCGA
CTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTGCTCCTGTCGCCTTCGCCTC
CTAATCCCTAGCCACTATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCA
GATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCA
GATGCCAAGTGACAAGACCATTGGGGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGA
GACGGGCGCTGGCAAGCACGTGCCCCGGGCTGTGTTTGTAGACTTGGAACCCACAGTCAT
TGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGG
CAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACTAACCTTAACCGCCTTAT
TAGCCAGATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGA
CCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCTCTGGCCAC
ATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGAT
CACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAA
ATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGC
CATTGCCACCATCAAAACCAAGCGCAGCATCCAGTTTTGTGGATTGGTGGCCCCACTGGC
TTNCAGGTGGGCATCAACTACCAGCCTNCCACCTGTGGTGCCTGGGTGGAGACCTGGCCA
AGGTAC
Tag Tag Free
ACCN BC021564
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC021564.1, AAH21564
RefSeq Size 1292
Locus ID 10376
Cytogenetics 12q13.12
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
Gene Summary Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.