MTHFR (NM_005957) Human Untagged Clone

CAT#: SC125935

Reviews ()
Write a review

MTHFR (untagged)-Human methylenetetrahydrofolate reductase (NAD(P)H) (MTHFR)



  "NM_005957" in other vectors (6)

USD 477.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MTHFR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005957 edited
CCGGCGGCCGAGCGTTCTGAGTCACCCGGGACTGGAGGTAGGAACCCAGCCATGGTGAAC
GAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGT
GAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCTGAGCGGCATGAG
AGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAA
TTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATG
GCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCA
GACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAG
ACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCAC
AAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGAC
CAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGA
AGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAA
GCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGAT
TTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGC
ACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCAC
TCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTG
ATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTG
AGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTC
AACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCC
AGGCGTCCCCTACCCTGGGCTCTCAGTGCCCACCCCAAGCGCCGAGAGGAAGATGTACGT
CCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAG
TTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTAC
TACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAG
GAGCTGACCAGTGAAGCAAGTGTCTTTGAAGTCTTTGTTCTTTACCTCTCGGGAGAACCA
AACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAG
ACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAAC
TCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGC
GGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAA
GCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTG
AAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATC
TTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGG
AAGGACGAGGCCTTTGCCCTGTGGATTGAGCAGTGGGGAAAGCTGTATGAGGAGGAGTCC
CCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGAC
AATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTC
AACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGACCCTGCGTCCTGACGCCC
TGCGTTGGAGCCACTCCTGTCCCGCCTTCCTCCTCCACAGTGCTGCTTCTCTTGGGAACT
CCACTCTCCTTCGTGTCTCTCCCACCCCGGCCTCCACTCCCCCACCTGACAATGGCAGCT
AGACTGGAGTGAGGCTTCCAGGCTCTTCCTGGACCTGAGTCGGCCCCACATGGGAACCTA
GTACTCTCTGCTCTAGCCAGGAGTCTGTGCTCTTTTGGTGGGGAGCACTTGCGTCCTGCA
GAGGACCACAGTGGGTGGCACCTCCTGAGAAGGCGAGGAGAGTGGTTGTTGCCAACTAAG
CCCTCGAACCAAGGCAGCCTCCAGAGCCAGCCTGGGACTCCCAGTGAACTTACACTTGGA
GCCCGTGCAGTACAGGCAAAACACGCAAGGGCATCAGGCACTGGTGGCATCGTAGAAGAG
ATGTGGCAAAGTGCTGTACCCTTCCACCTCCTAGAGGTGGGCAGCTGGGCCCCACCTACT
TGTGACTGAAGGGGCACACCACTGCCCTGCCTGCCCACTTAGCCGTCCATGGCACCAGCC
CCCTGGATGGGCATTGGGCTGACACCTACCATGCTGCTTTTTGGCACAGTTGTCTATTCT
GAGCCTTGAGAGAAAAAGTGCCCCTTAAGGGTTGAAGGCAGTCTGAACCCTTGTGCTTGG
TGGGGCTCGTGGCCTTCCCCTTTTGCCTGGCTGTGGAGGCCTGATGCTGCCCCGTTCCCT
GTCAGAGGCTAAGATGAGATTTGCCAGCACAGGGGCCCCAGATCTGCCTGGGCCTGTGCA
GCAGCCCAGCTTCCTGGTGTATTTTTCAGGTAGGCCCTTGTCCTGCCAGCTGCCTTCCTC
ATCCCCTCGTCCTGTCCCAGAGGTTATCTGCCTGGCCTGGCTCCCCACGAGTCACCTGCA
AGCCCCAGGGCCTGGGGGCAGTGACTGGCAGGTGCAGATGGGCTGTTTCGTGTAGTGGAA
GAGCAGCCTGATGGCCAAGGGGGTGGACGCAATTGTGGGATGTCCTCTTTACTCCCTTCC
TGGCCTCACTGGCTGGGGCAGAGGGGCAGCCGCTAGGAGAGACTGAAAGCAGCAGCTAGG
ACTGAGGAGTGGGTTTTATTGTCCTTCAGAGCTCTTCAAGCTGTCCCCTCTGTCATCACT
CCCTGGATGTGTGGGGCATGGTTCCTTCCCTGGGAAGGCTAAGTTCAGTTCTGTTTTTTA
TTCTATGAGAACAAGTCACAGCTGCAGCTGGGCCCCATGCTCTGCCCCAAGCCCCCAACC
CCGCGGTGCTCCGGCGGCTTCCTGTCCACTCTCGGGGCCCTTGGGGCCTGGCTTGCTCCA
GGGTCTTGGGCTACTGGCAGCTCCTCTCCTTGGGCTCCTGGCTGCCAGGCGTTGGTGCCA
CTTCTTAAAGGCCTGGAACCAGGGAGGAGAGGAAATGCTATTGTTGTGGGCTTTCTCCGG
GGTCTGTGCTGTGCCTGCTAGAGCAACCCCTGTACCCAGCTCCTTTTGTCCCCAGGGCCC
CTCCCTCTGCCCCAAGCAGCCAGCCAGTCTTGCCTAGGCCAAATGCACAAGCTCAGAATA
GATCTGATGGTGAGCTGGGAAGCTGTACTCAGAGCAGAGCAAATGAGGGAGGGGGCGCTC
AGGACCCAGGCCCTCCATGGGCTAGTGTGAGTGGCAGCCATGCCTCATGCCACACCTTCT
TCGCAAACTGATGGACCGGGTGGGCCTGGCCTGAGCTGGGGCCACAAATCAAAGCAAGGG
CTCCAGTATCCAGCCTGTGTGTTCTGTAATGGAACTGACCCCCTCCCCTGAAAACGAAGG
GGCCCCGGGGCTGGCAAGCAGGGAAAGCTCCACGGTGCGCGGCTGTGGCACAGACTTCTG
GAAGGCTGGCTGAGTGGAATGCAGGGAAGAGGGCAGTACCTGGGAAAGGACCCACCCATC
TTCCTGCTGCTGTAACTGCTGAGCCACTCGCAGTCGCAGGATCCGCTGCCACCACGTCTG
CCAGGCCCATCTCAGGTGCCACTCCCTGAGCTTTGGGGACAGTTGGCAGAGAAGGCCTCT
TGTGCTCACGCTCCCCCGCAGTCCCCAGCCCTTCTGCCTTTCTCCCCCGACACTGCTGCA
CCAGAGTGAAAGGGCTATGGCAAGGGGGTGTCATCTGAGGAGTATTAAGAATGCAGATTC
CTGGGCCTGTCCCCCAAGGTTTTGGAGTCAGTAGGTCCAAGGGCCATACTTTTGAGAGGG
GTTTGGGTTAAGTATGAGGTGAAATGGGAGATGGTCAGTGTGGAGAGGGGTGCACCCACT
CACCAGGGTCCGCACCAGCTGCTCTGCCCCTTGGGCATCCACCCAGTGCTGCCATGCCAC
TGCCAGGCACCTGGCCTGCTGGGAACCCCGCAGCCCGTGAAGCAGTGCCTCGAGGCACCG
GCGCTGCAGGTACTTCCTCCTGATGGCCAAGAGCATCGTGACCCTTCAGGGCCAGAAGGA
GGGCAGAGCCATGGGCCTGGGCCTGCTTTTCCAGGATCCTGCAGGAACGAGCACTGGCCA
GAGAGGGCCCAGCTGTAGCCATGGCTCAGGCAAGCCCCTCAGCCCTTGCCCCCATCCCTC
GGACCCACCAAACTGCACACACAGCTCCTCTTACCGTAGCCTCCGTTTATGGGCCTTGCT
TTGGGCTTTGGAGGCTCTGGGCTCAGGGCTGGAGTGCGCTCTTGGTCCCTGGTCCCTCGT
CCACAGGGGCAGGCCTGGGACCCAGCTACTCTGTCCAGGCCACTGTGGCCAGAGCTGGAA
GGCAGGGCAGAGGGAATGTTCCCTGCACCCTGGAAAGGGGAGTTGAGTCACAAGAGTTTA
AGGTGGGTCCAGGAAGGCAGCTGCTCTTAGTGCCCGCTTAGGAGTTGAGTACAGTGAGGA
GGGTGGAGGAAGGTGCTGAGCTTAGCCTTGTGCCCTGCCCCCATCTCCCCAGGCCTCCAG
CCTCTCACGGCTGCCTGCCGCCCAAAGAGAAATCACAGGGGCGGGGCAGGAATGCAAAGT
GTTTTCTCAGAACAGCTGAAACATTCCGAAGAGGGAATGGATGGGGAGAATGGTCAATAC
ACATAAGACCGTGTCCCAAGGAGCTGATTTCCAGGCCCCTGAGGACTGGAGACCGCTTCA
CCCCTGCACTTCAGACACCGTTTGTCCCCCGGGGCAAGGTCTCCTTACTCTGAGCCCAGG
CCGTTCCCCTTGGCTTCCTCCGTCCACCCAGGCTGCACTGCAGTGATGGCGCGGGAGGCA
CCAGCTCTGTGGCCTGTGTCCAGCAGCTGTGGGTCTGAAGGAATAGCCAGAGAGGAGCAC
CTGAACCCCATGGGCTTGGACTTCCTGGGGCCCCGCTGGGATTTCTTCGCTGCTCTAGCT
GGCAGGACACATCCCGGCCTCTTCCACCCATTCCCCCATGTGGCTGAAGACATTCCAACA
ATGGGGTGGGCCCATAATAGTTAGCCCTCAGTCAGTTCCCGGAGCACAGCCCTGGGAGGG
GGCTATTTCTCTCCCCACTGAAAACATTTCAAAGCTGAGTTACTTGTCTGAGGCCTCATC
CCTCGGAAGCCGTCTGACTCCAGAGTCTGAGCCCCCGGCTAGTACCCTATAGAGAGGGGG
CTCTCCAAAGGGGCTGCTGGGGCATGTGTGCCTGTGGCAGAAAAGAGGAGACCCTGGAAT
TCAGCACCCTGGGTGCCATTCCCAGCGTTTAGTTTCTAGAGGCCTCAGTTTCTCCATCAG
CTTATGGGATCCTTGTCTTTACTGACAAGAATGGAATAGAAATGTAAAAGTACTCTGAAA
AGCAATTGCCCTGTAACTTATCTAGAAAGAAAAGACCCTGAGACTCCAGAATCTGCTGTT
GCCATAGCCCCATATGTGTGAATTCTGCAACTAGCCAAGGCTAGTTCCTTTCAATTCCAT
TTAAAAAACAAAAACCAGCAGGTGTGGTGGCTCATGGCGTAATGGGCCTGCCCAATGCTT
TGGGAGGCCAAGGCAGATAGATCGCTTGAGCCCAGGAGTTTGAGACAAGCCCTGGCAACA
TAGTGAGATCCCATTTCTACAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_005957 unedited
NGGGTCAGATTTTGTATACGACTCATATAGGCGGCGCGCGAATTCGCACGAGGCCGGCGG
CCGAGCGTTCTGAGTCACCCGGGGGTGGAGGTAGGAACCCAGCCATGGTGAACGAAGCCA
GAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCT
CCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCTGAGCGGCATGAGAGACTCC
GGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCC
CTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAG
GTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGG
AGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCC
TGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTA
AGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGG
AAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGT
TTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCCGAGCAGGGA
GCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAAGTGTCTGCGGGAGCCGATTTCATCA
TCACGCAGCTTTTTCTTTGAGGCTGACACATTCTTTTCGCTTTGTGAAGGCATGCACCGA
CATGGGCATCACTTGGCCCATCGTCCCCGGGATCTTTTCCATNCAGGGCTACACTCCCTT
TCGCAGCTGG
Restriction Sites Please inquire     
ACCN NM_005957
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005957.2, NP_005948.2
RefSeq Size 6099 bp
RefSeq ORF 1971 bp
Locus ID 4524
UniProt ID P42898
Cytogenetics 1p36.22
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Methane metabolism, One carbon pool by folate
Gene Summary The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Other products for "MTHFR"
Frequently bought together (4)
MTHFR mouse monoclonal antibody,clone OTI2H3
    • 100 ul

USD 417.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.