SAPK4(MAPK13) (BC004428) Human Untagged Clone

CAT#: SC125845

MAPK13 (untagged)-Human mitogen-activated protein kinase 13, mRNA (cDNA clone MGC:3830 IMAGE:2819932), complete cds

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SAPK4(MAPK13) (BC004428) Human Untagged Clone
Symbol MAPK13
Synonyms SAPK4;MGC99536; PRKM13; p38delta; OTTHUMP00000016282; mitogen-activated protein kinase p38 delta; stress-activated protein kinase 4; mitogen-activated protein kinase 13
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for BC004428 edited
CGCAGCCGCCACGCCGGGGCCGCCGAGATCGGGTGCCCGGGATGAGCCTCATCCGGAAAA
AGGGCTTCTACAAGCAGGACGTCAACAAGACCGCCTGGGAGCTGCCCAAGACCTACGTGT
CCCCGACGCACGTCGGCAGCGGGGCCTATGGCTCCGTGTGCTCGGCCATCGACAAGCGGT
CAGGGGAGAAGGTGGCCATCAAGAAGCTGAGCCGACCCTTTCAGTCCGAGATCTTCGCCA
AGCGCGCCTACCGGGAGCTGCTGCTGCTGAAGCACATGCAGCATGAGAACGTCATTGGGC
TCCTGGATGTCTTCACCCCAGCCTCCTCCCTGCGCAACTTCTATGACTTCTACCTGGTGA
TGCCCTTCATGCAGACGGATCTGCAGAAGATCATGGGGATGGAGTTCAGTGAGGAGAAGA
TCCAGTACCTGGTGTATCAGATGCTCAAAGGCCTTAAGTACATCCACTCTGCTGGGGTCG
TGCACAGGGACCTGAAGCCAGGCAACCTGGCTGTGAATGAGGACTGTGAACTGAAGATTC
TGGATTTTGGGCTGGCGCGACATGCAGACGCCGAGATGACTGGCTACGTGGTGACCCGCT
GGTACCGAGCCCCCGAGGTGATCCTCAGCTGGATGCACTACAACCAGACAGTGGACATCT
GGTCTGTGGGCTGTATCATGGCAGAGATGCTGACAGGGAAAACTCTGTTCAAGGGGAAAG
ATTACCTGGACCAGCTGACCCAGATCCTGAAAGTGACCGGGGTGCCTGGCACGGAGTTTG
TGCAGAAGCTGAACGACAAAGCGGCCAAATCCTACATCCAGTCCCTGCCACAGACCCCCA
GGAAGGATTTCACTCAGCTGTTCCCACGGGCCAGCCCCCAGGCTGCGGACCTGCTGGAGA
AGATGCTGGAGCTAGACGTGGACAAGCGCCTGACGGCCGCGCAGGCCCTCACCCATCCCT
TCTTTGAACCCTTCCGGGACCCTGAGGAAGAGACGGAGGCCCAGCAGCCGTTTGATGATT
CCTTAGAACACGAGAAACTCACAGTGGATGAATGGAAGCAGCACATCTACAAGGAGATTG
TGAACTTCAGCCCCATTGCCCGGAAGGACTCACGGCGCCGGAGTGGCATGAAGCTGTAGG
GACTCATCTTGCATGGCACCACCGGCCAGACACTGCCCAAGGACCAGTATTTGTCACTAC
CAAACTCAGCCCTTCTTGGAATACAGCCTTTCAAGCAGAGGACAGAAGGGTCCTTCTCCT
TATGTGGGAAATGGGCCTAGTAGATGCAGAATTCAAAGATGTCGGTTGGGAGAAACTAGC
TCTGATCCTAACAGGCCACGTTAAACTGCCCATCTGGAGAATCGCCTGCAGGTGGGGCCC
TTTCCTTCCCGCCAGAGTGGGGCTGAGTGGGCGCTGAGCCAGGCCGGGGGCCTATGGCAG
TGATGCTGTGTTGGTTTCCTAGGGATGCTCTAACGAATTACCACAAACCTGGTGGATTGA
AACAGCAGAACTTGATTCCCTTACAGTTCTGGAGGCTGGAAATCTGGGATGGAGGTGTTG
GCAGGGCTGTGGTCCCTTTGAAGGCTCTGGGGAAGAATCCTTCCTTGGCTCTTTTTAGCT
TGTGGCGGCAGTGGGCAGTCCGTGGCATTCCCCAGCTTATTGCTGCATCACTCCAGTCTC
TGTCTCTTCTGTTCTCTCCTCTTTTAACAACAGTCATTGGATTTAGGGCCCACCCTAATC
CTGTGTGATCTTATCTTGATCCTTATTAATTAAACCTGCAAATACTCTAGTTCCAAATAA
AGTCACATTCTCAGGTAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for BC004428 unedited
NCGTCAGATTTTGTATACGACTCACTAAGGGCGGCCGCGAATTCGCACGAGGCGCAGCCG
CCACGCCGGGGCCGCCGAGATCGGGTGCCCGGGATGAGCCTCATCCGGAAAAGGGCTTCT
ACAAGCAGGACGTCAACAAGACCGCCTGGGAGCTGCCCAAGACCTACGTGTCCCCGACGC
ACGTCGGCAGCGGGGCCTATGGCTCCGTGTGCTCGGCCATCGACAAGCGGTCAGGGGAGA
AGGTGGCCATCAAGAAGCTGAGCCGACCCTTTCAGTCCGAGATCTTCGCCAAGCGCGCCT
ACCGGGAGCTGCTGCTGCTGAAGCACATGCAGCATGAGAACGTCATTGGGCTCCTGGATG
TCTTCACCCCAGCCTCCTCCCTGCGCAACTTCTATGACTTCTACCTGGTGATGCCCTTCA
TGCAGACGGATCTGCAGAAGATCATGGGGATGGAGTTCAGTGAGGAGAAGATCCAGTACC
TGGTGTATCAGATGCTCAAAGGCCTTAAGTACATCCACTCTGCTGGGGTCGTGCACAGGG
ACCTGAAGCCAGGCAACCTGGCTGTGAATGAGGACTGTGAACTGAAGATTCTGGATTTTG
GGCTGGCGCGACATGCAGACGCCGAGATGACTGGCTACGTGGTGACCCGCTGGTACCGAG
CCCCCGAGGTGATCCTCAGCTGGATGCACTACAACCAGACAGTGGACATCTGGTCTGTGG
GCTGTATCATGGCAGAGATGCTGACAGGGAAAACTCTGTTCAAGGGGAAAGATTACCTGG
ACCAGCTGACCCAGATCCTGANAGTGACCGGGGTGCCTGGCACGGAGTTTGTGCAGAAGC
TGAACGANCAAGCGGCCAAATCCTACATCCAGTCCCTGCCACAGACCCCCCAGAAGGATT
CACTCAGCTGTTCCCACGGGCCAGCCCCCAGCTGCGGAA
Tag Tag Free
ACCN BC004428
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC004428.1, AAH04428
RefSeq Size 1834
Locus ID 5603
Cytogenetics 6p21.31
Protein Families Protein Kinase, Druggable Genome
Protein Pathways MAPK signaling pathway, VEGF signaling pathway, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway, Fc epsilon RI signaling pathway, Leukocyte transendothelial migration, Neurotrophin signaling pathway, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Amyotrophic lateral sclerosis (ALS), Epithelial cell signaling in Helicobacter pylori infection
Gene Summary This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.