GLI1 (NM_005269) Human Untagged Clone

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name GLI1 (NM_005269) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol GLI1
Synonyms GLI; PAPA8; PPD1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_005269 edited
CCCAGACAGAGTGTCCCCACACCCTCCTCTGAGACGCCATGTTCAACTCGATGACCCCAC
CACCAATCAGTAGCTATGGCGAGCCCTGCTGTCTCCGGCCCCTCCCCAGTCAGGGGGCCC
CCAGTGTGGGGACAGAAGGACTGTCTGGCCCGCCCTTCTGCCACCAAGCTAACCTCATGT
CCGGCCCCCACAGTTATGGGCCAGCCAGAGAGACCAACAGCTGCACCGAGGGCCCACTCT
TTTCTTCTCCCCGGAGTGCAGTCAAGTTGACCAAGAAGCGGGCACTGTCCATCTCACCTC
TGTCGGATGCCAGCCTGGACCTGCAGACGGTTATCCGCACCTCACCCAGCTCCCTCGTAG
CTTTCATCAACTCGCGATGCACATCTCCAGGAGGCTCCTACGGTCATCTCTCCATTGGCA
CCATGAGCCCATCTCTGGGATTCCCAGCCCAGATGAATCACCAAAAAGGGCCCTCGCCTT
CCTTTGGGGTCCAGCCTTGTGGTCCCCATGACTCTGCCCGGGGTGGGATGATCCCACATC
CTCAGTCCCGGGGACCCTTCCCAACTTGCCAGCTGAAGTCTGAGCTGGACATGCTGGTTG
GCAAGTGCCGGGAGGAACCCTTGGAAGGTGATATGTCCAGCCCCAACTCCACAGGCATAC
AGGATCCCCTGTTGGGGATGCTGGATGGGCGGGAGGACCTCGAGAGAGAGGAGAAGCGTG
AGCCTGAATCTGTGTATGAAACTGACTGCCGTTGGGATGGCTGCAGCCAGGAATTTGACT
CCCAAGAGCAGCTGGTGCACCACATCAACAGCGAGCACATCCACGGGGAGCGGAAGGAGT
TCGTGTGCCACTGGGGGGGCTGCTCCAGGGAGCTGAGGCCCTTCAAAGCCCAGTACATGC
TGGTGGTTCACATGCGCAGACACACTGGCGAGAAGCCACACAAGTGCACGTTTGAAGGGT
GCCGGAAGTCATACTCACGCCTCGAAAACCTGAAGACGCACCTGCGGTCACACACGGGTG
AGAAGCCATACATGTGTGAGCACGAGGGCTGCAGTAAAGCCTTCAGCAATGCCAGTGACC
GAGCCAAGCACCAGAATCGGACCCATTCCAATGAGAAGCCGTATGTATGTAAGCTCCCTG
GCTGCACCAAACGCTATACAGATCCTAGCTCGCTGCGAAAACATGTCAAGACAGTGCATG
GTCCTGACGCCCATGTGACCAAACGGCACCGTGGGGATGGCCCCCTGCCTCGGGCACCAT
CCATTTCTACAGTGGAGCCCAAGAGGGAGCGGGAAGGAGGTCCCATCAGGGAGGAAAGCA
GACTGACTGTGCCAGAGGGTGCCATGAAGCCACAGCCAAGCCCTGGGGCCCAGTCATCCT
GCAGCAGTGACCACTCCCCGGCAGGGAGTGCAGCCAATACAGACAGTGGTGTGGAAATGA
CTGGCAATGCAGGGGGCAGCACTGAAGACCTCTCCAGCTTGGACGAGGGACCTTGCATTG
CTGGCACTGGTCTGTCCACTCTTCGCCGCCTTGAGAACCTCAGGCTGGACCAGCTACATC
AACTCCGGCCAATAGGGACCCGGGGTCTCAAACTGCCCAGCTTGTCCCACACCGGTACCA
CTGTGTCCCGCCGCGTGGGCCCCCCAGTCTCTCTTGAACGCCGCAGCAGCAGCTCCAGCA
GCATCAGCTCTGCCTATACTGTCAGCCGCCGCTCCTCCCTGGCCTCTCCTTTCCCCCCTG
GCTCCCCACCAGAGAATGGAGCATCCTCCCTGCCTGGCCTTATGCCTGCCCAGCACTACC
TGCTTCGGGCAAGATATGCTTCAGCCAGAGGGGGTGGTACTTCGCCCACTGCAGCATCCA
GCCTGGATCGGATAGGTGGTCTTCCCATGCCTCCTTGGAGAAGCCGAGCCGAGTATCCAG
GATACAACCCCAATGCAGGGGTCACCCGGAGGGCCAGTGACCCAGCCCAGGCTGCTGACC
GTCCTGCTCCAGCTAGAGTCCAGAGGTTCAAGAGCCTGGGCTGTGTCCATACCCCACCCA
CTGTGGCAGGGGGAGGACAGAACTTTGATCCTTACCTCCCAACCTCTGTCTACTCACCAC
AGCCCCCCAGCATCACTGAGAATGCTGCCATGGATGCTAGAGGGCTACAGGAAGAGCCAG
AAGTTGGGACCTCCATGGTGGGCAGTGGTCTGAACCCCTATATGGACTTCCCACCTACTG
ATACTCTGGGATATGGGGGACCTGAAGGGGCAGCAGCTGAGCCTTATGGAGCGAGGGGTC
CAGGCTCTCTGCCTCTTGGGCCTGGTCCACCCACCAACTATGGCCCCAACCCCTGTCCCC
AGCAGGCCTCATATCCTGACCCCACCCAAGAAACATGGGGTGAGTTCCCTTCCCACTCTG
GGCTGTACCCAGGCCCCAAGGCTCTAGGTGGAACCTACAGCCAGTGTCCTCGACTTGAAC
ATTATGGACAAGTGCAAGTCAAGCCAGAACAGGGGTGCCCAGTGGGGTCTGACTCCACAG
GACTGGCACCCTGCCTCAATGCCCACCCCAGTGAGGGGCCCCCACATCCACAGCCTCTCT
TTTCCCATTACCCCCAGCCCTCTCCTCCCCAATATCTCCAGTCAGGCCCCTATACCCAGC
CACCCCCTGATTATCTTCCTTCAGAACCCAGGCCTTGCCTGGACTTTGATTCCCCCACCC
ATTCCACAGGGCAGCTCAAGGCTCAGCTTGTGTGTAATTATGTTCAATCTCAACAGGAGC
TACTGTGGGAGGGTGGGGGCAGGGAAGATGCCCCCGCCCAGGAACCTTCCTACCAGAGTC
CCAAGTTTCTGGGGGGTTCCCAGGTTAGCCCAAGCCGTGCTAAAGCTCCAGTGAACACAT
ATGGACCTGGCTTTGGACCCAACTTGCCCAATCACAAGTCAGGTTCCTATCCCACCCCTT
CACCATGCCATGAAAATTTTGTAGTGGGGGCAAATAGGGCTTCACATAGGGCAGCAGCAC
CACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCCTCTCAAAGTGGGAGGCACAA
ACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCCTTGTACCCTC
CTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGG
ACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGC
GGGGCAGCTCTGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACA
TGAGTGTCTTACTGAGATCCCTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAA
GAGTAGGGAATCTCATCCATCACAGATCGCATTTCCTAAGGGGTTTCTATCCTTCCAGAA
AAATTGGGGGAGCTGCAGTCCCCTGCACAAGATGCCCCAGGGATGGGAGGTATGGGCTGG
GGGCTATGTATAGTCTGTATACGTTTTGAGGAGAAATTTGATAATGACACTGTTTCCTGA
TAATAAAGGAACTGCATCAGAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_005269 unedited
NNGGGTTCAAAATTGTATACGACTCATATAGGCGGACCGCGAATTCGCACGAGGCCCAGA
CAGAGTGTCCCCACACCCTCCTCTGAGACGCCATGTTCAACTCGATGACCCCACCACCAA
TCAGTAGCTATGGCGAGCCCTGCTGTCTCCGGCCCCTCCCCAGTCAGGGGGCCCCCAGTG
TGGGGACAGAAGGACTGTCTGGCCCGCCCTTCTGCCACCAAGCTAACCTCATGTCCGGCC
CCCACAGTTATGGGCCAGCCAGAGAGACCAACAGCTGCACCGAGGGCCCACTCTTTTCTT
CTCCCCGGAGTGCAGTCAAGTTGACCAAGAAGCGGGCACTGTCCATCTCACCTCTGTCGG
ATGCCAGCCTGGACCTGCAGACGGTTATCCGCACCTCACCCAGCTCCCTCGTAGCTTTCA
TCAACTCGCGATGCACATCTCCAGGAGGCTCCTACGGTCATCTCTCCATTGGCACCATGA
GCCCATCTCTGGGATTCCCAGCCCAGATGAATCACCAAAAAGGGCCCTCGCCTTCCTTTG
GGGTCCAGCCTTGTGGTCCCCATGACTCTGCCCGGGGTGGGATGATCCCACATCCTCAGT
CCCGGGGACCCTTCCCAACTTGCCAGCTGAAGTCTGAGCTGGACATGCTGGTTGGCAAGT
GCCGGGAGGAACCCTTGGAAGGTGATATGTCCAGCCCCAACTCCACAGGCATACAGGATC
CCCTGTTGNGGATGCTGGATGGGCGGGAGGACCTCGAGAGAGAGGAAAGCGTGAGCCTGA
ATCTGTGTATGAAACTGACTGCCGTTGGGATGGCTGCAGCCAGGAATTTGACTCCCAAGA
CAGCTGGTGCACCACATCAACAGCGAGCACATCCACGGNGAGCGGAAGGAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005269
Insert Size 3600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005269.1, NP_005260.1
RefSeq Size 3600 bp
RefSeq ORF 3321 bp
Locus ID 2735
Cytogenetics 12q13.3
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell relevant signaling - DSL/Notch pathway, Transcription Factors
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Pathways in cancer
Gene Summary This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (1) encodes the full length protein (isoform 1).

Citations (1)

Other Versions

Other products for "GLI1"
Frequently bought together (2)
GLI1 mouse monoclonal antibody, clone OTI4E2 (formerly 4E2)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools