GJA1(GJA1) (NM_000165) Human Untagged Clone

CAT#: SC125548

GJA1 (untagged)-Human gap junction protein, alpha 1, 43kDa (GJA1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GJA1(GJA1) (NM_000165) Human Untagged Clone
Symbol GJA1
Synonyms AVSD3; CMDR; CX43; EKVP; GJAL; HLHS1; HSS; ODDD; PPKCA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC125548 sequence for NM_000165 edited (data generated by NextGen Sequencing)
ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCT
GGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCG
GTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGT
TGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTG
CAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATG
CGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGT
GTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAA
GAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTC
TTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGC
TTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTC
TCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCC
CTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTT
AAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGT
GGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCT
ATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAAT
TACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATG
GGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGAT
AACCAGAATTCTAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGAC
CAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTG
GAGATCTAG

Clone variation with respect to NM_000165.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000165 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCTCGTGCCGAATTCGGC
ACGAGTATCAGCACTTTTCTTTCATTAGGGGGAAGGCGTGAGGAAAGTACCAAACAGCAG
CGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACT
TCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTG
CTGGGGACAGCGGTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACT
CAGCAACCTGGTTGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGC
TTCTGGGTCCTGCAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTG
TTCTATGTGATGCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCC
CAACTGATGGTGTCAATGTGGACATGCACTTGAAGCAGATCGAATAAAAGAAGTTCAAGT
ACGGTATTGAAGAGCATGGNTAGGTGAAATGCGAGGGGGGGGGTTGCTGCNAACCTACAT
CATCAGTATCCTCTTCAGTCATTTTTTGAGGGTGCCTCTTGCTGATNCCAGTGGACATCT
ATGGATTCNCTTGGGAGGGCTGGTTACACTGCAAAAAAGACCCTGCACATCAGGGGGGGC
CGTGTTCCTCTCTCGCCCACGGAGAAACATCTCATATTCTGCCGGGGGGGGGGCNCCGTG
GGGGCCCTGGCCTGAAATAAATGACTCTTTTTGTTTTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000165 unedited
GCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTATACTAAATTAAAACTT
TATTGAATAAAGAACACTCTCCAGAACACATGATCTGATGGACTAGGTCTACATTACATG
CAATGAAGCTGAACATGACCGTAGTTTAACATGGAATGTCAAACAAATTAGTAATTTTCA
TTGTACAAAACTGTTTATGTAGCTGACATGCATGCAAGAAGAAAAGTGTCATACTCAGCA
TTTTCACCAATCTTCTGTGATGAGTTTTAAAAAAGGCATTTGGAGAAACTGGTAGATGTC
TTCAACATATAGTTCAAATAAATTAGTTGTATGTGTACTACTGAATCCTCTTTCAACCTC
TCTTGCATTCCAAATAAAATCTTAGTGCAAACATCAAAGTTGCTGGTCACTCCAAAAGAC
TGCTAAACTCATAATAGAATACAAGTTCTGAATTACTGTGTATTAAGTAGGAAAACCCAA
GAATACCAGTTACTGCAAAATTCATTTAGGCACATTTAATAGTCCACTCTAAGCATTTTT
TCTAAGTCTCTCACATTAATGACTAAAGCCTGTTTACAGTACTAAAATTCTATCATTCAA
GCATCAATGATTACATTTCAGAAAAAGGAAATTCATTTCAGTAATAGCATTACTGCTATA
TCCTANAAAAAGGAGAGAAAATAAAGAATCATAATTAACAAAACCAGTATCCATAATAGG
ATACACAGGGGAAAAACATTNTAGGAGAAANAAAAAGTGTGCTTTACTTGCCCAGCANGA
ATATATAATGTAAACACATATTGGCCACACACAAAAATCTGAGAAGGTTNCAATTTGACC
CATAGTGCATATTTTCAAACTGNGTTGNGAGTTTACTGATCTGGCTGACATACTGACAAC
AAACAACTCTCAACACTATATGATGGTATATAGCTGGCTGTTCCTGACTTACTAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000165
ORF Size 1149 bp
Insert Size 2940
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000165.2, NP_000156
RefSeq Size 3088
RefSeq ORF 1149
Locus ID 2697
Cytogenetics 6q22.31
Domains CNX, Connexin43
Protein Families Ion Channels: Other, Transmembrane, Druggable Genome
Protein Pathways Gap junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC)
Gene Summary This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations