Telomerase reverse transcriptase(TERT) (NM_198253) Human Untagged Clone

CAT#: SC125522

TERT (untagged)-Human telomerase reverse transcriptase (TERT), transcript variant 1

USD 2,163.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Telomerase reverse transcriptase(TERT) (NM_198253) Human Untagged Clone
Symbol TERT
Synonyms CMM9; DKCA2; DKCB4; EST2; hEST2; hTRT; PFBMFT1; TCS1; TP2; TRT
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_198253 edited
CCGCGATGCCGCGCGCTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCACTACC
GCGAGGTGCTGCCGCTGGCCACGTTCGTGCGGCGCCTGGGGCCCCAGGGCTGGCGGCTGG
TGCAGCGCGGGGACCCGGCGGCTTTCCGCGCGCTGGTGGCCCAGTGCCTGGTGTGCGTGC
CCTGGGACGCACGGCCGCCCCCCGCCGCCCCCTCCTTCCGCCAGGTGTCCTGCCTGAAGG
AGCTGGTGGCCCGAGTGCTGCAGAGGCTGTGCGAGCGCGGCGCGAAGAACGTGCTGGCCT
TCGGCTTCGCGCTGCTGGACGGGGCCCGAGGGGGCCCCCCCGAGGCCTTCACCACCAGCG
TGCGCAGCTACCTGCCCAACACGGTGACCGACGCACTGCGGGGGAGCGGGGCGTGGGGGC
TGCTGCTGCGCCGCGTGGGCGACGACGTGCTGGTTCACCTGCTGGCACGCTGCGCGCTCT
TTGTGCTGGTGGCTCCCAGCTGCGCCTACCAGGTGTGCGGGCCGCCGCTGTACCAGCTCG
GCGCTGCCACTCAGGCCCGGCCCCCGCCACACGCTAGTGGACCCCGAAGGCGTCTGGGAT
GCGAACGGGCCTGGAACCATAGCGTCAGGGAGGCCGGGGTCCCCCTGGGCCTGCCAGCCC
CGGGTGCGAGGAGGCGCGGGGGCAGTGCCAGCCGAAGTCTGCCGTTGCCCAAGAGGCCCA
GGCGTGGCGCTGCCCCTGAGCCGGAGCGGACGCCCGTTGGGCAGGGGTCCTGGGCCCACC
CGGGCAGGACGCGTGGACCGAGTGACCGTGGTTTCTGTGTGGTGTCACCTGCCAGACCCG
CCGAAGAAGCCACCTCTTTGGAGGGTGCGCTCTCTGGCACGCGCCACTCCCACCCATCCG
TGGGCCGCCAGCACCACGCGGGCCCCCCATCCACATCGCGGCCACCACGTCCCTGGGACA
CGCCTTGTCCCCCGGTGTACGCCGAGACCAAGCACTTCCTCTACTCCTCAGGCGACAAGG
AGCAGCTGCGGCCCTCCTTCCTACTCAGCTCTCTGAGGCCCAGCCTGACTGGCGCTCGGA
GGCTCGTGGAGACCATCTTTCTGGGTTCCAGGCCCTGGATGCCAGGGACTCCCCGCAGGT
TGCCCCGCCTGCCCCAGCGCTACTGGCAAATGCGGCCCCTGTTTCTGGAGCTGCTTGGGA
ACCACGCGCAGTGCCCCTACGGGGTGCTCCTCAAGACGCACTGCCCGCTGCGAGCTGCGG
TCACCCCAGCAGCCGGTGTCTGTGCCCGGGAGAAGCCCCAGGGCTCTGTGGCGGCCCCCG
AGGAGGAGGACACAGACCCCCGTCGCCTGGTGCAGCTGCTCCGCCAGCACAGCAGCCCCT
GGCAGGTGTACGGCTTCGTGCGGGCCTGCCTGCGCCGGCTGGTGCCCCCAGGCCTCTGGG
GCTCCAGGCACAACGAACGCCGCTTCCTCAGGAACACCAAGAAGTTCATCTCCCTGGGGA
AGCATGCCAAGCTCTCGCTGCAGGAGCTGACGTGGAAGATGAGCGTGCGGGACTGCGCTT
GGCTGCGCAGGAGCCCAGGGGTTGGCTGTGTTCCGGCCGCAGAGCACCGTCTGCGTGAGG
AGATCCTGGCCAAGTTCCTGCACTGGCTGATGAGTGTGTACGTCGTCGAGCTGCTCAGGT
CTTTCTTTTATGTCACGGAGACGACGTTTCAAAAGAACAGGCTCTTTTTCTACCGGAAGA
GTGTCTGGAGCAAGTTGCAAAGCATTGGAATCAGACAGCACTTGAAGAGGGTGCAGCTGC
GGGAGCTGTCGGAAGCAGAGGTCAGGCAGCATCGGGAAGCCAGGCCCGCCCTGCTGACGT
CCAGACTCCGCTTCATCCCCAAGCCTGACGGGCTGCGGCCGATTGTGAACATGGACTACG
TCGTGGGAGCCAGAACGTTCCGCAGAGAAAAGAGGGCCGAGCGTCTCACCTCGAGGGTGA
AGGCACTGTTCAGCGTGCTCAACTACGAGCGGGCGCGGCGCCCCGGCCTCCTGGGCGCCT
CTGTGCTGGGCCTGGACGATATCCACAGGGCCTGGCGCACCTTCGTGCTGCGTGTGCGGG
CCCAGGACCCGCCGCCTGAGCTGTACTTTGTCAAGGTGGATGTGACGGGCGCGTACGACA
CCATCCCCCAGGACAGGCTCACGGAGGTCATCGCCAGCATCATCAAACCCCAGAACACGT
ACTGCGTGCGTCGGTATGCCGTGGTCCAGAAGGCCGCCCATGGGCACGTCCGCAAGGCCT
TCAAGAGCCACGTCTCTACCTTGACAGACCTCCAGCCGTACATGCGACAGTTCGTGGCTC
ACCTGCAGGAGACGAGCCCGCTGAGGGATGCCGTCGTCATCGAGCAGAGCTCCTCCCTGA
ATGAGGCCAGCAGTGGCCTCTTCGACGTGTTCCTACGCTTCATGTGCCACCACGCCGTGC
GCATCAGGGGCAAGTCCTACGTCCAGTGCCAGGGGATCCCGCAGGGCTCCATCCTCTCCA
CGCTGCTCTGCAGCCTGTGCTACGGCGACATGGAGAACAAGCTGTTTGCGGGGATTCGGC
GGGACGGGCTGCTCCTGCGTTTGGTGGATGATTTCTTGTTGGTGACACCTCACCTCACCC
ACGCGAAAACCTTCCTCAGGACCCTGGTCCGAGGTGTCCCTGAGTATGGCTGCGTGGTGA
ACTTGCGCAAGACAGTGGTGAACTTCCCTGTAGAAGATGAGGCCCTGGGTGGCACGGCTT
TTGTTCAGATGCCGGCCCACGGCCTATTCCCCTGGTGCGGCCTGCTGCTGGATACCCGGA
CCCTGGAGGTGCAGAGCGACTACTCCAGCTATGCCCGGACCTCCATCAGAGCCAGTCTCA
CCTTCAACCGCGGCTTCAAGGCTGGGAGGAACATGCGTCGCAAACTCTTTGGGGTCTTGC
GGCTGAAGTGTCACAGCCTGTTTCTGGATTTGCAGGTGAACAGCCTCCAGACGGTGTGCA
CCAACATCTACAAGATCCTCCTGCTGCAGGCGTACAGGTTTCATGCATGTGTGCTGCAGC
TCCCATTTCATCAGCAAGTTTGGAAGAACCCCACATTTTTCCTGCGCGTCATCTCTGACA
CGGCCTCCCTCTGCTACTCCATCCTGAAAGCCAAGAACGCAGGGATGTCGCTGGGGGCCA
AGGGCGCCGCCGGCCCTCTGCCCTCCGAGGCCGTGCAGTGGCTGTGCCACCAAGCATTCC
TGCTCAAGCTGACTCGACACCGTGTCACCTACGTGCCACTCCTGGGGTCACTCAGGACAG
CCCAGACGCAGCTGAGTCGGAAGCTCCCGGGGACGACGCTGACTGCCCTGGAGGCCGCAG
CCAACCCGGCACTGCCCTCAGACTTCAAGACCATCCTGGACTGATGGCCACCCGCCCACA
GCCAGGCCGAGAGCAGACACCAGCAGCCCTGTCACGCCGGGCTCTACGTCCCAGGGAGGG
AGGGGCGGCCCACACCCAGGCCCGCACCGCTGGGAGTCTAGGCCTGAGTGAGTGTTTGGC
CGAGGCCTGCATGTCCGGCTGAAGGCTGAGTGTCCGGCTGAGGCCTGAGCGAGTGTCCAG
CCAAGGGCTGAGTGTCCAGCACACCTGCCGTCTTCACTTCCCCACAGGCTGGCGCTCGGC
TCCACCCCAGGGCCAGCTTTTCCTCACCAGGAGCCCGGCTTCCACTCCCCACATAGGAAT
AGTCCATCCCCAGATTCGCCATTGTTCACCCCTCGCCCTGCCCTCCTTTGCCTTCCACCC
CCACCATCCAGGTGGAGACCCTGAGAAGGACCCTGGGAGCTCTGGGAATTTGGAGTGACC
AAAGGTGTGCCCTGTACACAGGCGAGGACCCTGCACCTGGATGGGGGTCCCTGTGGGTCA
AATTGGGGGGAGGTGCTGTGGGAGTAAAATACTGAATATATGAGTTTTTCAGTTTTGAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003219 unedited
GGCACTTTGAAATACGACTGACTATATGGCGGCCGCGAATTCGCCCTTGGCCACCCCCGC
GATGCCGCGCGCTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCACTACCGCGA
GGTGCTGCCGCTGGCCACGTTCGTGCGGCGCCTGGGGCCCCAGGGCTGGCGGCTGGTGCA
GCGCGGGGACCCGGCGGCTTTCCGCGCGCTGGTGGCCCAGTGCCTGGTGTGCGTGCCCTG
GGACGCACGGCCGCCCCCCGCCGCCCCCTCCTTCCGCCAGGTGTCCTGCCTGAAGGAGCT
GGTGGCCCGAGTGCTGCAGAGGCTGTGCGAGCGCGGCGCGAAGAACGTGCTGGCCTTCGG
CTTCGCGCTGCTGGACGGGGCCCGAGGGGGCCCCCCCGAGGCCTTCACCACCAGCGTGCG
CAGCTACCTGCCCAACACGGTGACCGACGCACTGCGGGGGAGCGGGGCGTGGGGGCTGCT
GCTGCGCCGCGTGGGCGACGACGTGCTGGTTCACCTGCTGGCACGCTGCGCGCTCTTTGT
GCTGGTTGGCTCCAGCTGCGCCTACCANGTGTGCGGGCCGCCGCTTGTACCAACTCGCGC
TGCCACTCAAGCCCGGCCCCCGCCACACGCTAGTGGACCCCGAAGGCGTCTGGGATGCGA
AGGGCCTGGAACCATACGTCAGGGAGCCGGNGTCCCTGGCCTGCANCCCCGTTGCAAGAA
GCCCGGGCAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003219 unedited
GCAGTGTCAACTTCAGGGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGG
GATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAAAACTGAAAAACTC
ATATTTTCAGTATTTTACTCCCACAGCACCTCCCCCCAATTTGACCCACAGGGACCCCCA
TCCAGGTGCAGGGTCCTCGCCTGTGTACAGGGCACACCTTTGGTCACTCCAAATTCCCAG
AGCTCCCAGGGTCCTTCTCAGGGTCTCCACCTGGATGGGGGGGGTGGAAGGCAAAGGAGG
GCAGGGCGAGGGGTGAACAATGGCGAATCTGGGGATGGACTATTCCTATGTGGGGAGTGG
AACCCGGGCTCCTGGTGAGGAAAAGCTGGCCCTGGGGTGGAGCCGAGCGCCACCCTGTGG
GGAAGTGAAAACGGCAGGTGTGCTGGACACTCAGCCCTTGGCTGGACACTCGCTAAGGCC
TAAGCCGGACACTCAGCCTTTAGCCGGACATGCAGGCCTGGGCCAAACACTCACTCAGGC
CTNAGACTCCCAGCGGTGCGGGCCTGGGTGTGCCCGCCCCTCCTCCCTGGACGTANAGCC
CGCGTGACAGGCTGCTGTGTCTGTTTNGCCTGCTGGGGCGGTGGCATCATCCAGATGGTC
TTGATTTGAGGCATGGCCGGTTGCTGCGGCTTCAGGCAATAAGGTCTCCCCGGAACTTCC
AACTACTGGTTTGCTTGCTGGTGCACCAGATGGCCCTAGGACCGTTCAATCCCTGNGCAG
ATGTGGG
Tag Tag Free
ACCN NM_198253
ORF Size 3399 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_198253.2, NP_937983
RefSeq Size 4018
Locus ID 7015
Cytogenetics 5p15.33
Protein Families Druggable Genome
Gene Summary Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations