CD44 (NM_001001391) Human Untagged Clone

CAT#: SC125340

CD44 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human CD44 molecule (Indian blood group) (CD44),

USD 577


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD44 (NM_001001391) Human Untagged Clone
Symbol CD44
Synonyms CDW44; CSPG8; ECMR-III; HCELL; HUTCH-I; IN; LHR; MC56; MDU2; MDU3; MIC4; Pgp1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001001391, the custom clone sequence may differ by one or more nucleotides


ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGATT
TGAATATAACCTGCCGCTTTGCAGGTGTATTCCACGTGGAGAAAAATGGTCGCTACAGCATCTCTCGGAC
GGAGGCCGCTGACCTCTGCAAGGCTTTCAATAGCACCTTGCCCACAATGGCCCAGATGGAGAAAGCTCTG
AGCATCGGATTTGAGACCTGCAGGTATGGGTTCATAGAAGGGCACGTGGTGATTCCCCGGATCCACCCCA
ACTCCATCTGTGCAGCAAACAACACAGGGGTGTACATCCTCACATCCAACACCTCCCAGTATGACACATA
TTGCTTCAATGCTTCAGCTCCACCTGAAGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGAT
GGACCAATTACCATAACTATTGTTAACCGTGATGGCACCCGCTATGTCCAGAAAGGAGAATACAGAACGA
ATCCTGAAGACATCTACCCCAGCAACCCTACTGATGATGACGTGAGCAGCGGCTCCTCCAGTGAAAGGAG
CAGCACTTCAGGAGGTTACATCTTTTACACCTTTTCTACTGTACACCCCATCCCAGACGAAGACAGTCCC
TGGATCACCGACAGCACAGACAGAATCCCTGCTACCAGAGACCAAGACACATTCCACCCCAGTGGGGGGT
CCCATACCACTCATGGATCTGAATCAGATGGACACTCACATGGGAGTCAAGAAGGTGGAGCAAACACAAC
CTCTGGTCCTATAAGGACACCCCAAATTCCAGAATGGCTGATCATCTTGGCATCCCTCTTGGCCTTGGCT
TTGATTCTTGCAGTTTGCATTGCAGTCAACAGTCGAAGAAGGTGTGGGCAGAAGAAAAAGCTAGTGATCA
ACAGTGGCAATGGAGCTGTGGAGGACAGAAAGCCAAGTGGACTCAACGGAGAGGCCAGCAAGTCTCAGGA
AATGGTGCATTTGGTGAACAAGGAGTCGTCAGAAACTCCAGACCAGTTTATGACAGCTGATGAGACAAGG
AACCTGCAGAATGTGGACATGAAGATTGGGGTGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_001001391 unedited
GGGCTTCAGAATTGTATACGATTCACTATAGGCGGCCGCGAATTCGCACCAGGCCTCTGC
CTGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATC
CTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTG
GCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGATTTGAATAT
AACCTGCCGCTTTGCAGGTGTATTCCACGTGGAGAAAAATGGTCGCTACAGCATCTCTCG
GACGGAGGCCGCTGACCTCTGCAAGGCTTTCAATAGCACCTTGCCCACAATGGCCCAGAT
GGAGAAAGCTCTGAGCATCGGATTTGAGACCTGCAGGTATGGGTTCATAGAAGGGCACGT
GGTGATTCCCCGGATCCACCCCAACTCCATCTGTGCAGCAAACAACACAGGGGTGTACAT
CCTCACATCCAACACCTCCCAGTATGACACATATTGCTTCAATGCTTCAGCTCCACCTGA
AGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGATGGACCAATTACCATAAC
TATTGTTAACCGTGATGGCACCCGCTATGTCCAGAAAGGAGAATACAGAACGAATCCTGA
AGACATCTACCCCAGCAACCCTACTGATGATGACGTGAGCAGCGGCTCCTNCAGTGAAAG
GAGCAGCACTTCAGGAGGGTACATCTTTTACACCTTTTCTACTGTACACCCCATCCCAGA
CGAAGACAGTCCCTGGATCACCGACAGCACAGACAGAATNCCTGCTACCACAGNCTCAGC
TCATACCAGCCATTCATGGCAGGAAGGGACACACAGCCAGNAGACAGTCCTGGACTGATT
CTTCACCCATCTCACACCATGGNACGAGTCANAGCA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001001391 unedited
TTAGATCCTTCGGGCGATGGTCAACTTGCCAGGTCGAGGGGAGAGGCACTGGGGGCAGGG
GTACACAGGGCATGCCACCCGGGTATCTGTTCAGGAAAACAGCTATGACCGCGGCCGCAA
TCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTAAAAGAGTAGAAAATTTTATGCTAAAAA
AGATTCGCAATGAAACAATCAGTAGCACATTGCATCTGTTAAGTGTCCCAGCTCCCTGTA
ATGGTTATGTTTCCAACGGTTGTTTCTTTCCAAGATAATGGTGTAGGTGTTACACCCCAA
TCTTCATGTCCACATTCTGCAGGTTCCTTGTCTCATCAGCTGTCATAAACTGGTCTGGAG
TTTCTGACGACTCCTTGTTCACCAAATGCACCATTTCCTGAGACTTGCTGGCCTCTCCGT
TGAGTCCACTTGGCTTTCTGTCCTCCACAGCTCCATTGCCACTGTTGATCACTAGCTTTT
TCTTCTGCCCACACCTTCTTCGACTGTTGACTGCAATGCAAACTGCGAGAATCAAAGCCA
ACGCCAAGAGGGATGCCAAGATGATCAGCCATTCTGGAATTTGGGGTGCCCTTACAGGAC
CAGAGGTTGTGTTCGCTCCCACTTCTTGACTCCCATGTGAGGGTCCCTCTGATTCAAATC
CTGGAGTGGTAGGGGACCCCCCACGGGGGGTGGAATGGGATTAGGTCCCCCCGAAAAGGA
ACGATGGGGGGCAGATTGGGGAGACCCCAAGTTCAGTGATTGGAACGCCGACAGAACGGG
GCCAAAGGCGGGGAACTAGGCAGGACCCCGGCGGAAGTAACGTAGAATTTTGCGGAGGGA
GCGCACGAGAAGTAACAACAAAGAAGTGGAAGAAAACAACAGGGGTGGCGGCGGAGTCAA
TACACGGGACAGAGGAAGGTGTAGAGTCAGAGTGAGTAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001001391
ORF Size 1086 bp
Insert Size 2000
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001001391.1, NP_001001391
RefSeq Size 4605
RefSeq ORF 1086
Locus ID 960
Cytogenetics 11p13
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Cancer stem cells, Embryonic stem cells, Druggable Genome
Protein Pathways ECM-receptor interaction, Hematopoietic cell lineage
Gene Summary The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (4) lacks multiple coding-exons compared to variant 1. The translation remains in-frame. The resulting isoform (4) lacks an internal segment, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.