Nucleolin(NCL) (NM_005381) Human Untagged Clone

CAT#: SC125320

NCL (untagged)-Human nucleolin (NCL)

USD 1,360.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nucleolin(NCL) (NM_005381) Human Untagged Clone
Symbol NCL
Synonyms C23; C23
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC125320 sequence for NM_005381 edited (data generated by NextGen Sequencing)
ATGGTGAAGCTCGCGAAGGCAGGTAAAAATCAAGGTGACCCCAAGAAAATGGCTCCTCCT
CCAAAGGAGGTAGAAGAAGATAGTGAAGATGAGGAAATGTCAGAAGATGAAGAAGATGAT
AGCAGTGGAGAAGAGGTCGTCATACCTCAGAAGAAAGGCAAGAAGGCTGCTGCAACCTCA
GCAAAGAAGGTGGTCGTTTCCCCAACAAAAAAGGTTGCAGTTGCCACACCAGCCAAGAAA
GCAGCTGTCACTCCAGGCAAAAAGGCAGCAGCAACACCTGCCAAGAAGACAGTTACACCA
GCCAAAGCAGTTACCACACCTGGCAAGAAGGGAGCCACACCAGGCAAAGCATTGGTAGCA
ACTCCTGGTAAGAAGGGTGCTGCCATCCCAGCCAAGGGGGCAAAGAATGGCAAGAATGCC
AAGAAGGAAGACAGTGATGAAGAGGAGGATGATGACAGTGAGGAGGATGAGGAGGATGAC
GAGGACGAGGATGAGGATGAAGATGAAATTGAACCAGCAGCGATGAAAGCAGCAGCTGCT
GCCCCTGCCTCAGAGGATGAGGACGATGAGGATGACGAAGATGATGAGGATGACGATGAC
GATGAGGAAGATGACTCTGAAGAAGAAGCTATGGAGACTACACCAGCCAAAGGAAAGAAA
GCTGCAAAAGTTGTTCCTGTGAAAGCCAAGAACGTGGCTGAGGATGAAGATGAAGAAGAG
GATGATGAGGACGAGGATGACGACGACGACGAAGATGATGAAGATGATGATGATGAAGAT
GATGAGGAGGAGGAAGAAGAGGAGGAGGAAGAGCCTGTCAAAGAAGCACCTGGAAAACGA
AAGAAGGAAATGGCCAAACAGAAAGCAGCTCCTGAAGCCAAGAAACAGAAAGTGGAAGGC
ACAGAACCGACTACGGCTTTCAATCTCTTTGTTGGAAACCTAAACTTTAACAAATCTGCT
CCTGAATTAAAAACTGGTATCAGCGATGTTTTTGCTAAAAATGATCTTGCTGTTGTGGAT
GTCAGAATTGGTATGACTAGGAAATTTGGTTATGTGGATTTTGAATCTGCTGAAGACCTG
GAGAAAGCGTTGGAACTCACTGGTTTGAAAGTCTTTGGCAATGAAATTAAACTAGAGAAA
CCAAAAGGAAAAGACAGTAAGAAAGAGCGAGATGCGAGAACACTTTTGGCTAAAAATCTC
CCTTACAAAGTCACTCAGGATGAATTGAAAGAAGTGTTTGAAGATGCTGCGGAGATCAGA
TTAGTCAGCAAGGATGGGAAAAGTAAAGGGATTGCTTATATTGAATTTAAGACAGAAGCT
GATGCAGAGAAAACCTTTGAAGAAAAGCAGGGAACAGAGATCGATGGGCGATCTATTTCC
CTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACT
TGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAA
ACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGC
AAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTA
AATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCC
AGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCT
GAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATA
GTTACTGACCGGGAAACTGGGTCCTCCAAAGGGTTTGGTTTTGTAGACTTCAACAGTGAG
GAGGATGCCAAAGCTGCCAAGGAGGCCATGGAAGACGGTGAAATTGATGGAAATAAAGTT
ACCTTGGACTGGGCCAAACCTAAGGGTGAAGGTGGCTTCGGGGGTCGTGGTGGAGGCAGA
GGCGGCTTTGGAGGACGAGGTGGTGGTAGAGGAGGCCGAGGAGGATTTGGTGGCAGAGGC
CGGGGAGGCTTTGGAGGGCGAGGAGGCTTCCGAGGAGGCAGAGGAGGAGGAGGTGACCAC
AAGCCACAAGGAAAGAAGACGAAGTTTGAATAG

Clone variation with respect to NM_005381.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005381 unedited
ATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTCGAGCTCTCGC
TGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGGCCGCCATCGCCGTCGCT
TGGCTTCTTCTGGACTCATCTGCGCCACTTGTCCGCTTCACACTCCGCCGCCATCATGGT
GAAGCTCGCGAAGGCAGGTAAAAATCAAGGTGACCCCAAGAAAATGGCTCCTCCTCCAAA
GGAGGTAGAAGAAGATAGTGAAGATGAGGAAATGTCAGAAGATGAAGAAGATGATAGCAG
TGGAGAAGAGGTCGTCATACCTCAGAAGAAAGGCAAGAAGGCTGCTGCAACCTCAGCAAA
GAAGGTGGTCGTTTCCCCAACAAAAAAGGTTGCAGTTGCCACACCAGCCAAGAAAGCAGC
TGTCACTCCAGGCAAAAAGGCAGCAGCAACACCTGCCAAGAAGACAGTTACACCAGCCAA
AGCAGTTACCACACCTGGCAAGAAGGGAGCCACACCAGGCAAAGCATTGGTAGCAACTCC
TGGTAAGAAGGGTGCTGCCATCCCAGCCAAGGGGGCAAAGAATGGCAAGAATGCCAAGAA
GGAAGACAGTGATGAAGAGGAGGATGATGACAGTGAGGAGGATGAGGAGGATGACGAGGA
CGAGGATGAGGATGAAGATGAAATTGAACCAGCAGCGATGAAAGCAGCAGCTGGCTGCCC
CCTGCCTCANAGGATGAGGACGATGANGATGACGAANATGATGAGGATGACGATGACGAT
GAGGAAGATGACTCTGAAGAAGAGCTTGGNAGACTACACCAGCCAAGGAAAGAAAGCTGC
AAAGNTGNTCTGTGAAGCCNANAACGTGCTGAGGATGAAAAGAAAANAAGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005381 unedited
AATAGCTAGNACCGCGGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGGCACC
AAAGTTGACTTTTAATTTGTCCTAAAGCCGCTGAAGCAAAAACCATGATAAAACATTCTG
CTTTCTTTTCTTTTACAACCCCACGAACGCAAAAAAAAAAAAAACAAAAACAAAACAAAA
AAAAGAAACAACAACAAAACCCAAACTATTTGTAGGAAAAAATGGTTTTGTACATGGGAT
GAAACAATATAAATTCAAAACTTACAGATAAGGGTTAGCTCTATCACTCAACTCTTTAAA
AAGTTTATATGAATATCCAGTCAAAACCAACACGGTATTGCCCTTGAAATGTTAACTAGA
CGGATTTCCAAGGAGACCACAGGACTGTATACTGTCTTGGAATGTCCTCAGAAGGCTCTG
TCATTGATCAGGTAACAGTAAAAACCCCAGAGTCCTTTCTTTCAAATGGAAAAGGGAAAG
CAGAGGGACAGAAGCTATTCAAACTTCGTCTTCTTTCCTTGTGGCTTGTGGTCACCTCCT
CCTCCTCTGCCTCCTCGGAAGCCTCCTCGCCCTCCAAAGCCTCCCCGGCCTCTGCCACCA
AATCCTCCTCGGCCTCCTCTACCACCACCTCGTCCTCCAAAGCCGCCTCTGCCTCCACCA
CGACCCCCGAAGCCACCTTCACCCTTAGGTTTGGCCCAGTCCAAGTAACTTTATTTCCAT
CNTTTCACCGTCTTCCATGGCCTCCCTGGGAGCTTTGGCATCCCCCTCACTGTTGAAGTC
TACAAAACCAAACCCTTTGGAGGACCCAGTTTCCCGGGCAGTACTATCCTTGCCCGAACG
GACCCGCAAAAGACTCCTTAAAGGCCCTCAGGGGTACCCTCAAAAAGGCCTTGACAAAAG
ATTTTTGGAGGGCGGGCTCGGGAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005381
ORF Size 2133 bp
Insert Size 3000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005381.2, NP_005372
RefSeq Size 2732
Locus ID 4691
Cytogenetics 2q37.1
Domains rrm
Protein Families Stem cell - Pluripotency, Druggable Genome
Protein Pathways Pathogenic Escherichia coli infection
Gene Summary Nucleolin (NCL), a eukaryotic nucleolar phosphoprotein, is involved in the synthesis and maturation of ribosomes. It is located mainly in dense fibrillar regions of the nucleolus. Human NCL gene consists of 14 exons with 13 introns and spans approximately 11kb. The intron 11 of the NCL gene encodes a small nucleolar RNA, termed U20. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.